Incidental Mutation 'R0359:Bsn'
ID30006
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission 038565-MU
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R0359 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108111846 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 2236 (G2236S)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035208
AA Change: G2236S

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: G2236S

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
2310003L06Rik A T 5: 87,964,596 probably benign Het
Abcb5 A G 12: 118,940,332 S213P probably damaging Het
Agpat1 A G 17: 34,610,577 I42V probably benign Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
BB014433 G T 8: 15,042,540 C104* probably null Het
Casp9 A G 4: 141,793,910 E19G probably damaging Het
Ces1g T C 8: 93,328,535 probably benign Het
Cfap65 T A 1: 74,920,601 M797L probably benign Het
Col14a1 A G 15: 55,407,868 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col27a1 G T 4: 63,314,727 probably null Het
Col6a4 T A 9: 105,997,146 H2214L probably benign Het
Ctu2 T G 8: 122,478,193 S72R probably damaging Het
Cyp24a1 T A 2: 170,491,699 M245L possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Diaph3 T C 14: 86,969,502 R501G probably benign Het
Dip2b A G 15: 100,211,993 D1453G probably damaging Het
Dnah2 G A 11: 69,529,531 T119M probably benign Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Farp1 A T 14: 121,255,396 probably benign Het
Foxf1 T C 8: 121,085,003 V202A possibly damaging Het
Fras1 G A 5: 96,762,590 V3293I probably damaging Het
Fuk T C 8: 110,893,259 probably null Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Gclm T C 3: 122,255,620 probably benign Het
Gemin4 G A 11: 76,212,162 T591M probably benign Het
Glrx3 T C 7: 137,453,485 S119P possibly damaging Het
Gm16485 G T 9: 8,972,436 probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Kpna2 A G 11: 106,991,322 L226S probably damaging Het
Myom3 G A 4: 135,778,143 V448M probably damaging Het
Nalcn A G 14: 123,299,168 S1224P probably damaging Het
Olfr1354 A G 10: 78,917,343 T168A probably benign Het
Olfr504 C T 7: 108,565,514 D94N probably benign Het
Olfr666 A T 7: 104,893,314 F105I probably damaging Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pot1a G A 6: 25,771,680 probably benign Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ppp1r1a T A 15: 103,533,488 D51V probably damaging Het
Ptprz1 T A 6: 22,973,176 probably benign Het
Rad51ap1 A T 6: 126,934,741 V61D probably damaging Het
Reln G A 5: 22,048,800 L605F probably damaging Het
Riok3 T C 18: 12,148,949 I325T probably damaging Het
Sclt1 A T 3: 41,661,570 probably null Het
Slc25a39 A G 11: 102,406,569 V24A possibly damaging Het
Slc9a3 T G 13: 74,157,607 S248A probably damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Spen T C 4: 141,516,870 S285G unknown Het
Stxbp5l A G 16: 37,216,078 probably benign Het
Thsd7a G A 6: 12,352,031 P1055L probably damaging Het
Tmed3 C T 9: 89,699,789 S207N possibly damaging Het
Trerf1 G T 17: 47,341,136 noncoding transcript Het
Triml1 A T 8: 43,130,505 V353E probably damaging Het
Ttn G A 2: 76,719,057 R31759C probably damaging Het
Ugt2b37 T C 5: 87,250,584 Q331R probably benign Het
Urb1 A G 16: 90,791,160 I420T probably damaging Het
Vmn1r68 A T 7: 10,527,274 L299Q probably damaging Het
Vmn1r81 T A 7: 12,259,950 T244S probably damaging Het
Vps13a A G 19: 16,641,577 F2875S probably damaging Het
Wscd1 A G 11: 71,766,866 M166V probably damaging Het
Zfp296 T C 7: 19,579,939 Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAATAGACAGGTCCTTCAGCAG -3'
(R):5'- TTCAGATCATAGGTACGGCCCACG -3'

Sequencing Primer
(F):5'- GTCCTTCAGCAGGTGGAAC -3'
(R):5'- CCTGGAAACCTTGCTCAGTATG -3'
Posted On2013-04-24