Incidental Mutation 'R4127:Olfr1163'
ID315423
Institutional Source Beutler Lab
Gene Symbol Olfr1163
Ensembl Gene ENSMUSG00000075137
Gene Nameolfactory receptor 1163
SynonymsMOR174-8, GA_x6K02T2Q125-49563265-49562315
MMRRC Submission 040860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4127 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88069817-88071830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88071235 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 49 (V49A)
Ref Sequence ENSEMBL: ENSMUSP00000149399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099835] [ENSMUST00000215268]
Predicted Effect probably benign
Transcript: ENSMUST00000099835
AA Change: V49A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097423
Gene: ENSMUSG00000075137
AA Change: V49A

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.2e-44 PFAM
Pfam:7tm_1 43 292 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215268
AA Change: V49A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,191,973 H3R probably benign Het
Actg2 A T 6: 83,522,884 F128Y possibly damaging Het
Ankrd6 G A 4: 32,822,241 T176M probably damaging Het
Atp6ap1l T C 13: 90,898,707 D117G probably damaging Het
Cd209b A G 8: 3,918,714 I284T probably damaging Het
Cfl2 C T 12: 54,861,358 A123T probably benign Het
Cgnl1 T C 9: 71,724,540 T510A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Cyfip2 T C 11: 46,270,647 I339V probably benign Het
Etl4 C T 2: 20,744,075 P539L possibly damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Frem2 T C 3: 53,525,896 Y2669C probably damaging Het
Gga2 G T 7: 122,002,720 H205N probably damaging Het
Gm5592 G A 7: 41,289,067 G591D probably benign Het
Gtf3c1 A T 7: 125,647,450 C1562* probably null Het
Heatr3 T A 8: 88,138,311 C59S probably damaging Het
Heatr5b A G 17: 78,753,174 M2024T possibly damaging Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Lzts3 A G 2: 130,635,365 S502P probably damaging Het
Pcdhb2 A T 18: 37,295,541 D189V probably damaging Het
Pias3 G T 3: 96,699,666 G82C probably damaging Het
Polg T C 7: 79,455,537 E753G probably damaging Het
Pus10 T C 11: 23,718,654 probably null Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rag1 A G 2: 101,642,071 Y909H probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 C T 13: 11,587,437 V4520I possibly damaging Het
Scp2 A G 4: 108,063,984 F10L probably benign Het
Slc9b2 T C 3: 135,329,837 Y356H probably benign Het
Sorcs1 T C 19: 50,222,159 D756G probably benign Het
Stra6 T A 9: 58,151,218 V454E probably damaging Het
Tbc1d8 T C 1: 39,372,431 N1108S probably benign Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tmem132d T C 5: 128,268,820 R213G probably benign Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Xcr1 A C 9: 123,856,496 V67G probably damaging Het
Zranb2 C A 3: 157,537,590 C74* probably null Het
Other mutations in Olfr1163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Olfr1163 APN 2 88071124 missense possibly damaging 0.56
IGL01472:Olfr1163 APN 2 88070978 missense possibly damaging 0.56
IGL02111:Olfr1163 APN 2 88071227 missense probably benign 0.22
R1274:Olfr1163 UTSW 2 88070595 missense probably damaging 1.00
R1938:Olfr1163 UTSW 2 88070956 missense probably damaging 1.00
R2012:Olfr1163 UTSW 2 88070719 missense probably benign 0.03
R3056:Olfr1163 UTSW 2 88071239 missense probably benign
R4748:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4749:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4769:Olfr1163 UTSW 2 88070729 missense probably benign 0.25
R6647:Olfr1163 UTSW 2 88070709 missense probably benign 0.03
R7111:Olfr1163 UTSW 2 88070656 missense probably damaging 1.00
R7168:Olfr1163 UTSW 2 88070577 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGCGATCATAAGCCATAACTGC -3'
(R):5'- GCAAGTCTTCTGTCTCAGCTG -3'

Sequencing Primer
(F):5'- GCCATAACTGCTAGTAAGTAGGACTC -3'
(R):5'- TGTCCACTATGGTGCCACTGG -3'
Posted On2015-05-14