Incidental Mutation 'R4272:Ago3'
ID322208
Institutional Source Beutler Lab
Gene Symbol Ago3
Ensembl Gene ENSMUSG00000028842
Gene Nameargonaute RISC catalytic subunit 3
SynonymseIF2C3, argonaute 3, C130014L07Rik
MMRRC Submission 041644-MU
Accession Numbers

Genbank: NM_153402; MGI: 2446634

Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R4272 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126331704-126429556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126355091 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 556 (T556S)
Ref Sequence ENSEMBL: ENSMUSP00000066633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069097] [ENSMUST00000127831] [ENSMUST00000132123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069097
AA Change: T556S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066633
Gene: ENSMUSG00000028842
AA Change: T556S

DomainStartEndE-ValueType
Pfam:ArgoN 20 167 9.4e-26 PFAM
DUF1785 176 228 3.48e-25 SMART
PAZ 236 371 4.18e-4 SMART
Pfam:ArgoL2 376 421 1.3e-14 PFAM
Pfam:ArgoMid 430 512 1.4e-34 PFAM
Piwi 518 819 2.96e-136 SMART
Blast:Piwi 826 852 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127831
SMART Domains Protein: ENSMUSP00000118577
Gene: ENSMUSG00000028842

DomainStartEndE-ValueType
Piwi 1 125 9.56e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132123
SMART Domains Protein: ENSMUSP00000116204
Gene: ENSMUSG00000028842

DomainStartEndE-ValueType
Piwi 1 140 1.41e-19 SMART
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Gene trapped(22)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arl5b A G 2: 15,073,179 E105G probably damaging Het
Capza3 A G 6: 140,042,538 I288V probably benign Het
Chka G A 19: 3,875,737 probably benign Het
Cnpy4 G T 5: 138,192,591 V159F probably damaging Het
Crb1 T C 1: 139,323,311 I301V probably benign Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlec1 C T 9: 119,143,163 A1417V probably damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dync1li2 A G 8: 104,423,143 S411P probably damaging Het
Efnb2 T A 8: 8,620,698 S301C probably damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3 A G 13: 74,192,644 V347A probably damaging Het
Ezh1 A G 11: 101,194,908 F641S probably damaging Het
Gcgr T A 11: 120,538,424 probably benign Het
Gm4887 G T 7: 104,821,328 noncoding transcript Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Htt G A 5: 34,849,069 V1441I possibly damaging Het
Lmtk2 A G 5: 144,183,226 M1398V probably benign Het
Lrrc15 T C 16: 30,273,855 N222S probably benign Het
Mctp2 A T 7: 72,259,331 V78E possibly damaging Het
Medag A G 5: 149,422,163 Y103C probably damaging Het
Mphosph9 G A 5: 124,304,203 P361S probably damaging Het
Npffr2 G A 5: 89,568,023 V70M probably damaging Het
Obox3-ps8 A C 17: 36,453,017 noncoding transcript Het
Olfr1222 A G 2: 89,125,362 V123A probably damaging Het
Pdgfra G A 5: 75,183,070 V751I probably benign Het
Phykpl T C 11: 51,585,528 L25P probably damaging Het
Rgl1 A T 1: 152,536,289 I443N probably benign Het
Riok3 AGAAGCGG AG 18: 12,135,941 probably benign Het
Rragd T C 4: 32,996,099 probably null Het
Rtcb A T 10: 85,957,619 M30K probably damaging Het
Rusc2 T A 4: 43,415,533 C280S probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Skp2 C A 15: 9,116,860 probably null Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Trhr G A 15: 44,197,224 V47I probably damaging Het
Trpm2 A T 10: 77,933,642 N749K probably damaging Het
Ttc27 T A 17: 74,840,360 W636R probably damaging Het
Ttc30a1 A G 2: 75,980,474 Y422H probably damaging Het
Ttn C A 2: 76,778,347 R17775L probably damaging Het
Vmn2r55 A G 7: 12,668,179 F394S probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zyx A G 6: 42,350,946 D70G probably damaging Het
Other mutations in Ago3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ago3 APN 4 126371541 missense probably damaging 1.00
IGL01826:Ago3 APN 4 126403282 missense probably damaging 1.00
IGL02285:Ago3 APN 4 126350877 missense possibly damaging 0.88
IGL02869:Ago3 APN 4 126367787 splice site probably benign
IGL03068:Ago3 APN 4 126417378 missense probably damaging 0.99
D4043:Ago3 UTSW 4 126351003 missense probably damaging 1.00
R0506:Ago3 UTSW 4 126417252 missense possibly damaging 0.79
R0545:Ago3 UTSW 4 126417232 missense probably damaging 1.00
R0764:Ago3 UTSW 4 126355092 missense possibly damaging 0.82
R1445:Ago3 UTSW 4 126371787 missense probably benign
R1706:Ago3 UTSW 4 126370292 missense probably damaging 1.00
R1909:Ago3 UTSW 4 126346737 missense probably damaging 1.00
R1944:Ago3 UTSW 4 126353727 missense probably damaging 1.00
R1974:Ago3 UTSW 4 126346751 missense probably damaging 1.00
R2239:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2380:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2424:Ago3 UTSW 4 126404247 missense probably damaging 1.00
R2571:Ago3 UTSW 4 126363811 missense probably damaging 1.00
R3121:Ago3 UTSW 4 126417372 missense probably benign
R3122:Ago3 UTSW 4 126417372 missense probably benign
R4022:Ago3 UTSW 4 126368593 missense probably benign 0.31
R4079:Ago3 UTSW 4 126353680 critical splice donor site probably null
R4533:Ago3 UTSW 4 126345563 missense probably damaging 1.00
R4575:Ago3 UTSW 4 126346682 missense probably benign 0.06
R4656:Ago3 UTSW 4 126363752 nonsense probably null
R4782:Ago3 UTSW 4 126347872 splice site probably null
R4783:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4784:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4785:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4799:Ago3 UTSW 4 126347872 splice site probably null
R5013:Ago3 UTSW 4 126368598 missense probably benign 0.18
R5180:Ago3 UTSW 4 126367751 missense probably benign 0.01
R5692:Ago3 UTSW 4 126355069 unclassified probably null
R5801:Ago3 UTSW 4 126371768 missense possibly damaging 0.53
R5955:Ago3 UTSW 4 126355050 missense probably damaging 1.00
R6730:Ago3 UTSW 4 126371545 missense probably null 0.04
T0722:Ago3 UTSW 4 126404263 missense probably benign
T0722:Ago3 UTSW 4 126404296 missense probably benign 0.21
T0722:Ago3 UTSW 4 126404305 missense probably benign
T0722:Ago3 UTSW 4 126404310 missense probably benign 0.00
T0975:Ago3 UTSW 4 126404263 missense probably benign
T0975:Ago3 UTSW 4 126404305 missense probably benign
T0975:Ago3 UTSW 4 126404310 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTATTGGTTAAATTCTCTGCCTC -3'
(R):5'- GATACATTTCAAGGGATCCTTCATAG -3'

Sequencing Primer
(F):5'- AGACAGGGTCTCACTGTATAGTCC -3'
(R):5'- CAAGGGATCCTTCATAGCTTTACTG -3'
Posted On2015-06-20