Incidental Mutation 'R5180:Ago3'
ID399698
Institutional Source Beutler Lab
Gene Symbol Ago3
Ensembl Gene ENSMUSG00000028842
Gene Nameargonaute RISC catalytic subunit 3
SynonymseIF2C3, argonaute 3, C130014L07Rik
MMRRC Submission 042760-MU
Accession Numbers

Genbank: NM_153402; MGI: 2446634

Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126331704-126429556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126367751 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 435 (V435I)
Ref Sequence ENSEMBL: ENSMUSP00000066633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069097]
Predicted Effect probably benign
Transcript: ENSMUST00000069097
AA Change: V435I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066633
Gene: ENSMUSG00000028842
AA Change: V435I

DomainStartEndE-ValueType
Pfam:ArgoN 20 167 9.4e-26 PFAM
DUF1785 176 228 3.48e-25 SMART
PAZ 236 371 4.18e-4 SMART
Pfam:ArgoL2 376 421 1.3e-14 PFAM
Pfam:ArgoMid 430 512 1.4e-34 PFAM
Piwi 518 819 2.96e-136 SMART
Blast:Piwi 826 852 5e-7 BLAST
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Gene trapped(22)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Ago3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ago3 APN 4 126371541 missense probably damaging 1.00
IGL01826:Ago3 APN 4 126403282 missense probably damaging 1.00
IGL02285:Ago3 APN 4 126350877 missense possibly damaging 0.88
IGL02869:Ago3 APN 4 126367787 splice site probably benign
IGL03068:Ago3 APN 4 126417378 missense probably damaging 0.99
D4043:Ago3 UTSW 4 126351003 missense probably damaging 1.00
R0506:Ago3 UTSW 4 126417252 missense possibly damaging 0.79
R0545:Ago3 UTSW 4 126417232 missense probably damaging 1.00
R0764:Ago3 UTSW 4 126355092 missense possibly damaging 0.82
R1445:Ago3 UTSW 4 126371787 missense probably benign
R1706:Ago3 UTSW 4 126370292 missense probably damaging 1.00
R1909:Ago3 UTSW 4 126346737 missense probably damaging 1.00
R1944:Ago3 UTSW 4 126353727 missense probably damaging 1.00
R1974:Ago3 UTSW 4 126346751 missense probably damaging 1.00
R2239:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2380:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2424:Ago3 UTSW 4 126404247 missense probably damaging 1.00
R2571:Ago3 UTSW 4 126363811 missense probably damaging 1.00
R3121:Ago3 UTSW 4 126417372 missense probably benign
R3122:Ago3 UTSW 4 126417372 missense probably benign
R4022:Ago3 UTSW 4 126368593 missense probably benign 0.31
R4079:Ago3 UTSW 4 126353680 critical splice donor site probably null
R4272:Ago3 UTSW 4 126355091 missense possibly damaging 0.95
R4533:Ago3 UTSW 4 126345563 missense probably damaging 1.00
R4575:Ago3 UTSW 4 126346682 missense probably benign 0.06
R4656:Ago3 UTSW 4 126363752 nonsense probably null
R4782:Ago3 UTSW 4 126347872 splice site probably null
R4783:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4784:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4785:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4799:Ago3 UTSW 4 126347872 splice site probably null
R5013:Ago3 UTSW 4 126368598 missense probably benign 0.18
R5692:Ago3 UTSW 4 126355069 unclassified probably null
R5801:Ago3 UTSW 4 126371768 missense possibly damaging 0.53
R5955:Ago3 UTSW 4 126355050 missense probably damaging 1.00
R6730:Ago3 UTSW 4 126371545 missense probably null 0.04
T0722:Ago3 UTSW 4 126404263 missense probably benign
T0722:Ago3 UTSW 4 126404296 missense probably benign 0.21
T0722:Ago3 UTSW 4 126404305 missense probably benign
T0722:Ago3 UTSW 4 126404310 missense probably benign 0.00
T0975:Ago3 UTSW 4 126404263 missense probably benign
T0975:Ago3 UTSW 4 126404305 missense probably benign
T0975:Ago3 UTSW 4 126404310 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACATCCCTCCATGGCCTCT -3'
(R):5'- TCTCCTTCCACTATATGAGTTCTTGG -3'

Sequencing Primer
(F):5'- ACTTCCTTTGGTGATGAACAGC -3'
(R):5'- GTAAAGACCTGCTGAACCGTCTTG -3'
Posted On2016-07-06