Incidental Mutation 'R4291:Pcdhb1'
ID323096
Institutional Source Beutler Lab
Gene Symbol Pcdhb1
Ensembl Gene ENSMUSG00000051663
Gene Nameprotocadherin beta 1
SynonymsPcdhbA
MMRRC Submission 041081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4291 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37264938-37267525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 37265417 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 140 (L140F)
Ref Sequence ENSEMBL: ENSMUSP00000057519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052366] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000052366
AA Change: L140F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057519
Gene: ENSMUSG00000051663
AA Change: L140F

DomainStartEndE-ValueType
CA 45 131 1.04e-1 SMART
CA 155 240 1.23e-19 SMART
CA 264 345 8.4e-27 SMART
CA 369 450 5.31e-15 SMART
CA 474 560 6.27e-26 SMART
CA 590 671 6.05e-10 SMART
Pfam:Cadherin_C_2 687 772 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,066,188 F27S probably benign Het
AK157302 T A 13: 21,495,545 D80E probably damaging Het
Amz2 T C 11: 109,434,055 probably null Het
Angel1 A G 12: 86,720,283 Y440H probably damaging Het
Ankrd34c T A 9: 89,729,764 K175* probably null Het
Arid1b C A 17: 5,040,663 S546R probably damaging Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Brpf3 G A 17: 28,823,975 V997M probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Cd96 T A 16: 46,071,749 Q292L probably damaging Het
Cdh18 C A 15: 22,714,551 probably benign Het
Cfb T G 17: 34,861,138 D122A possibly damaging Het
Copa G T 1: 172,092,397 probably benign Het
Ctnna2 T A 6: 76,882,745 K854N probably damaging Het
Cwh43 G A 5: 73,411,932 V106M probably benign Het
Dact2 C T 17: 14,196,571 E456K probably benign Het
Dnah8 T C 17: 30,748,559 S2582P probably benign Het
Eef2 A G 10: 81,179,580 T312A probably benign Het
Enpep T A 3: 129,270,317 R934* probably null Het
Fam240b A T 13: 64,481,813 M63K possibly damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm6124 A T 7: 39,222,771 noncoding transcript Het
Gsn G A 2: 35,290,420 V147I probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Hectd3 A G 4: 116,995,692 E97G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krba1 C T 6: 48,415,665 P802S possibly damaging Het
Lca5l C T 16: 96,178,774 S52N probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Map3k4 G T 17: 12,255,260 Q845K probably benign Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mccc1 A G 3: 35,990,068 V203A probably damaging Het
Mcm9 C A 10: 53,547,572 M677I probably benign Het
Mkrn2 A G 6: 115,617,434 T369A possibly damaging Het
Mthfr C A 4: 148,055,492 N623K probably damaging Het
Myh2 T C 11: 67,181,159 V571A probably benign Het
Nom1 G A 5: 29,446,372 probably null Het
Nucb1 T A 7: 45,495,280 D283V probably damaging Het
Olfr1120 G A 2: 87,358,075 M210I probably benign Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Olfr310 A T 7: 86,269,760 F10I probably damaging Het
Ptgs2 G A 1: 150,100,251 A10T probably benign Het
Rfx3 C T 19: 27,800,232 R497Q probably damaging Het
Rps6kb1 A T 11: 86,519,876 probably benign Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Tet3 T C 6: 83,373,199 T961A probably damaging Het
Ttc27 T C 17: 74,856,479 L694P probably damaging Het
Vmn1r238 G A 18: 3,123,214 Q67* probably null Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwf A T 6: 125,642,322 Y1321F probably damaging Het
Wfdc1 C A 8: 119,679,455 P103Q probably damaging Het
Zfp488 C A 14: 33,970,894 C104F possibly damaging Het
Other mutations in Pcdhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Pcdhb1 APN 18 37267342 missense probably benign 0.06
IGL01622:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01623:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01663:Pcdhb1 APN 18 37267133 missense possibly damaging 0.83
IGL01665:Pcdhb1 APN 18 37267397 missense probably benign 0.01
IGL01780:Pcdhb1 APN 18 37266522 missense probably damaging 1.00
IGL02121:Pcdhb1 APN 18 37265785 missense probably benign 0.06
IGL02468:Pcdhb1 APN 18 37266178 missense probably benign 0.21
IGL02602:Pcdhb1 APN 18 37266796 missense probably damaging 1.00
K3955:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0329:Pcdhb1 UTSW 18 37267024 missense possibly damaging 0.59
R0627:Pcdhb1 UTSW 18 37265721 missense probably damaging 1.00
R0848:Pcdhb1 UTSW 18 37267422 missense probably benign 0.00
R1187:Pcdhb1 UTSW 18 37265544 missense probably damaging 1.00
R1290:Pcdhb1 UTSW 18 37265230 missense possibly damaging 0.54
R1928:Pcdhb1 UTSW 18 37266180 nonsense probably null
R1957:Pcdhb1 UTSW 18 37265707 missense probably damaging 1.00
R2897:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R2898:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R3037:Pcdhb1 UTSW 18 37265113 missense probably damaging 1.00
R4193:Pcdhb1 UTSW 18 37267146 missense probably damaging 0.99
R4308:Pcdhb1 UTSW 18 37266661 missense probably benign 0.00
R4332:Pcdhb1 UTSW 18 37265530 missense probably damaging 1.00
R4606:Pcdhb1 UTSW 18 37265528 nonsense probably null
R4637:Pcdhb1 UTSW 18 37265749 missense possibly damaging 0.95
R5159:Pcdhb1 UTSW 18 37266363 missense possibly damaging 0.89
R5207:Pcdhb1 UTSW 18 37266462 missense probably damaging 1.00
R5211:Pcdhb1 UTSW 18 37266651 missense probably benign 0.06
R5273:Pcdhb1 UTSW 18 37265713 missense probably benign 0.23
R5335:Pcdhb1 UTSW 18 37267255 missense probably benign 0.00
R5398:Pcdhb1 UTSW 18 37266154 missense probably damaging 1.00
R5452:Pcdhb1 UTSW 18 37265758 missense possibly damaging 0.94
R5837:Pcdhb1 UTSW 18 37265827 missense possibly damaging 0.57
R5882:Pcdhb1 UTSW 18 37267177 missense probably benign 0.05
R5947:Pcdhb1 UTSW 18 37266673 missense possibly damaging 0.74
R6109:Pcdhb1 UTSW 18 37265253 missense possibly damaging 0.69
R7052:Pcdhb1 UTSW 18 37266529 missense probably damaging 1.00
R7082:Pcdhb1 UTSW 18 37266991 missense probably damaging 0.99
R7137:Pcdhb1 UTSW 18 37267392 missense possibly damaging 0.69
R7229:Pcdhb1 UTSW 18 37266687 missense probably damaging 1.00
T0970:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAAGACTGGAGATTTGTTC -3'
(R):5'- TGGTCAAGTTGACTTCAGGC -3'

Sequencing Primer
(F):5'- TGTTCGTCAAAGAGAAACTAGATCGC -3'
(R):5'- CTATCCAGGGGATTATCCAGC -3'
Posted On2015-06-20