Incidental Mutation 'R4371:Bckdk'
ID325998
Institutional Source Beutler Lab
Gene Symbol Bckdk
Ensembl Gene ENSMUSG00000030802
Gene Namebranched chain ketoacid dehydrogenase kinase
SynonymsBCKD-kinase
MMRRC Submission 041117-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R4371 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127904082-127910221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127906419 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 238 (A238V)
Ref Sequence ENSEMBL: ENSMUSP00000146115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071056] [ENSMUST00000124533] [ENSMUST00000151451] [ENSMUST00000206140] [ENSMUST00000206745]
Predicted Effect probably benign
Transcript: ENSMUST00000071056
AA Change: A238V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000070345
Gene: ENSMUSG00000030802
AA Change: A238V

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
Pfam:BCDHK_Adom3 69 222 1.8e-44 PFAM
HATPase_c 264 404 2.06e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124533
AA Change: A238V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146574
Predicted Effect probably benign
Transcript: ENSMUST00000151451
SMART Domains Protein: ENSMUSP00000116990
Gene: ENSMUSG00000030802

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
Pfam:BCDHK_Adom3 68 214 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206068
Predicted Effect probably benign
Transcript: ENSMUST00000206140
Predicted Effect probably benign
Transcript: ENSMUST00000206745
AA Change: A238V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Nullizygous mutations lead to altered amino acid metabolism, gait anomalies and neurobehavioral phenotypes. Homozygotes for a gene trapped allele show impaired growth, reduced fertility and epileptic seizures. Homozygotes for another gene trapped allele show motor delay and autism-like behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Alox12b G A 11: 69,169,616 R666H possibly damaging Het
Atp9a T C 2: 168,649,615 T677A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
C9 A G 15: 6,491,484 D470G probably damaging Het
Camsap2 A G 1: 136,287,963 F337L probably damaging Het
Cep152 G A 2: 125,613,047 R278W probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Chfr G A 5: 110,136,168 R36H probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Drp2 A T X: 134,435,135 probably benign Het
Dzip3 A G 16: 48,943,455 probably null Het
Emb A T 13: 117,268,930 D296V probably damaging Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gm6177 A T 1: 160,893,171 noncoding transcript Het
Hepacam2 A T 6: 3,486,988 V123E probably damaging Het
Iqsec1 A G 6: 90,694,606 S194P probably damaging Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnmb2 A G 3: 32,156,102 probably null Het
Nbeal1 A T 1: 60,289,946 K2174N possibly damaging Het
Ncapg G A 5: 45,678,455 M409I probably benign Het
Ocstamp A G 2: 165,397,313 S318P possibly damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Pom121l2 T C 13: 21,982,239 S227P probably benign Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Sptbn5 A G 2: 120,065,994 C729R probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tfap4 A G 16: 4,551,999 I4T probably damaging Het
Thrb C A 14: 18,030,275 Q340K probably damaging Het
Tnc T C 4: 63,970,351 Y1735C probably damaging Het
Ubr1 A T 2: 120,895,066 probably null Het
Other mutations in Bckdk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Bckdk APN 7 127905776 missense possibly damaging 0.67
IGL02176:Bckdk APN 7 127906373 missense probably benign 0.31
IGL02444:Bckdk APN 7 127907446 missense probably damaging 1.00
R2105:Bckdk UTSW 7 127907317 missense probably damaging 1.00
R2240:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R2252:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R2474:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3696:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3697:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3747:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3749:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3750:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3981:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R4091:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R4303:Bckdk UTSW 7 127905330 intron probably benign
R4367:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4369:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4841:Bckdk UTSW 7 127905461 unclassified probably null
R5615:Bckdk UTSW 7 127907317 missense probably damaging 1.00
R5930:Bckdk UTSW 7 127905973 missense probably damaging 1.00
R7215:Bckdk UTSW 7 127905110 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCCTTAGGGCTGAGGATGGG -3'
(R):5'- CCCTCCACTAGTTTAAGATGTCAGTAA -3'

Sequencing Primer
(F):5'- CTGAGGATGGGCTTGGGGC -3'
(R):5'- AAGAGCACTTGCCCTTCCTTATAGAG -3'
Posted On2015-07-06