Incidental Mutation 'R4371:Sdf2'
ID326004
Institutional Source Beutler Lab
Gene Symbol Sdf2
Ensembl Gene ENSMUSG00000002064
Gene Namestromal cell derived factor 2
Synonyms
MMRRC Submission 041117-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R4371 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78245746-78255496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78251037 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 66 (T66I)
Ref Sequence ENSEMBL: ENSMUSP00000002133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002133]
Predicted Effect probably damaging
Transcript: ENSMUST00000002133
AA Change: T66I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002133
Gene: ENSMUSG00000002064
AA Change: T66I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MIR 29 83 2.24e-11 SMART
MIR 91 146 5.47e-15 SMART
MIR 148 201 8.36e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154080
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is believed to be a secretory protein. It has regions of similarity to hydrophilic segments of yeast mannosyltransferases. Its expression is ubiquitous and the gene appears to be relatively conserved among mammals. Alternate splicing results in both coding and non-coding variants. A pseudogene of this gene is located on chromosome 15. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Alox12b G A 11: 69,169,616 R666H possibly damaging Het
Atp9a T C 2: 168,649,615 T677A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
C9 A G 15: 6,491,484 D470G probably damaging Het
Camsap2 A G 1: 136,287,963 F337L probably damaging Het
Cep152 G A 2: 125,613,047 R278W probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Chfr G A 5: 110,136,168 R36H probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Drp2 A T X: 134,435,135 probably benign Het
Dzip3 A G 16: 48,943,455 probably null Het
Emb A T 13: 117,268,930 D296V probably damaging Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gm6177 A T 1: 160,893,171 noncoding transcript Het
Hepacam2 A T 6: 3,486,988 V123E probably damaging Het
Iqsec1 A G 6: 90,694,606 S194P probably damaging Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnmb2 A G 3: 32,156,102 probably null Het
Nbeal1 A T 1: 60,289,946 K2174N possibly damaging Het
Ncapg G A 5: 45,678,455 M409I probably benign Het
Ocstamp A G 2: 165,397,313 S318P possibly damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Pom121l2 T C 13: 21,982,239 S227P probably benign Het
Sptbn5 A G 2: 120,065,994 C729R probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tfap4 A G 16: 4,551,999 I4T probably damaging Het
Thrb C A 14: 18,030,275 Q340K probably damaging Het
Tnc T C 4: 63,970,351 Y1735C probably damaging Het
Ubr1 A T 2: 120,895,066 probably null Het
Other mutations in Sdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02423:Sdf2 APN 11 78251018 missense probably damaging 1.00
R1591:Sdf2 UTSW 11 78254993 missense probably damaging 0.96
R2919:Sdf2 UTSW 11 78254854 missense probably damaging 0.97
R2920:Sdf2 UTSW 11 78254854 missense probably damaging 0.97
R4367:Sdf2 UTSW 11 78251037 missense probably damaging 1.00
R5970:Sdf2 UTSW 11 78246080 missense probably benign
R7130:Sdf2 UTSW 11 78245997 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TGTCAAGATCTAGAGATGCTGTAGAAG -3'
(R):5'- GAGCTAAGCACCAAGAGGCC -3'

Sequencing Primer
(F):5'- AGAAGGAGGTGTGATAGAGGTTTTCC -3'
(R):5'- CCAAGAGGCCAGACAAGTAGC -3'
Posted On2015-07-06