Incidental Mutation 'R0038:Ggt7'
ID32797
Institutional Source Beutler Lab
Gene Symbol Ggt7
Ensembl Gene ENSMUSG00000027603
Gene Namegamma-glutamyltransferase 7
Synonyms1110017C11Rik, 6330563L03Rik, Ggtl3
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R0038 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location155490379-155518237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155502781 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 214 (D214G)
Ref Sequence ENSEMBL: ENSMUSP00000135314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029131] [ENSMUST00000147601] [ENSMUST00000176117]
Predicted Effect probably benign
Transcript: ENSMUST00000029131
AA Change: D290G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029131
Gene: ENSMUSG00000027603
AA Change: D290G

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Pfam:G_glu_transpept 154 655 1.4e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138033
Predicted Effect probably benign
Transcript: ENSMUST00000147601
SMART Domains Protein: ENSMUSP00000120560
Gene: ENSMUSG00000027603

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Pfam:G_glu_transpept 154 202 6.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148296
Predicted Effect probably benign
Transcript: ENSMUST00000176117
AA Change: D214G

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135314
Gene: ENSMUSG00000027603
AA Change: D214G

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:G_glu_transpept 78 271 1.4e-63 PFAM
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a gene family that encodes enzymes involved in both the metabolism of glutathione and in the transpeptidation of amino acids. Changes in the activity of gamma-glutamyltransferase may signal preneoplastic or toxic conditions in the liver or kidney. The protein encoded by this gene consists of a heavy and a light chain, and it can interact with CT120, a plasma membrane-associated protein that is possibly involved in lung carcinogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Ggt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ggt7 APN 2 155500771 missense probably damaging 0.99
IGL02523:Ggt7 APN 2 155514703 missense probably damaging 1.00
IGL02999:Ggt7 APN 2 155502713 missense probably benign 0.00
R0030:Ggt7 UTSW 2 155506488 missense probably benign 0.00
R0106:Ggt7 UTSW 2 155494893 missense possibly damaging 0.63
R0106:Ggt7 UTSW 2 155494893 missense possibly damaging 0.63
R0683:Ggt7 UTSW 2 155506508 missense probably benign 0.08
R1035:Ggt7 UTSW 2 155506427 missense probably damaging 1.00
R1500:Ggt7 UTSW 2 155499046 missense probably benign 0.00
R1633:Ggt7 UTSW 2 155502688 missense probably damaging 1.00
R1693:Ggt7 UTSW 2 155506475 missense probably damaging 0.99
R1696:Ggt7 UTSW 2 155494979 missense possibly damaging 0.89
R1879:Ggt7 UTSW 2 155514787 missense possibly damaging 0.91
R2219:Ggt7 UTSW 2 155495719 missense probably damaging 1.00
R2220:Ggt7 UTSW 2 155495719 missense probably damaging 1.00
R4010:Ggt7 UTSW 2 155500732 missense probably benign 0.00
R5602:Ggt7 UTSW 2 155490999 missense possibly damaging 0.82
R5680:Ggt7 UTSW 2 155506433 missense probably damaging 1.00
R6092:Ggt7 UTSW 2 155518039 critical splice donor site probably null
R6440:Ggt7 UTSW 2 155498811 missense probably damaging 1.00
R6989:Ggt7 UTSW 2 155503460 missense probably benign 0.25
R7050:Ggt7 UTSW 2 155506375 missense probably benign 0.10
X0065:Ggt7 UTSW 2 155495695 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ACTGGTCTGATGTCTAGCACCAGAG -3'
(R):5'- TGTGGCCCAAGATGGCTTCAAC -3'

Sequencing Primer
(F):5'- attttgtttACAAAGTACACAACCAG -3'
(R):5'- AGATGGCTTCAACGTGACC -3'
Posted On2013-05-09