Incidental Mutation 'R0038:Cyp2b10'
ID32813
Institutional Source Beutler Lab
Gene Symbol Cyp2b10
Ensembl Gene ENSMUSG00000030483
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 10
Synonymsphenobarbitol inducible, type b, p16, Cyp2b20, Cyp2b
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0038 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location25897620-25926624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25914862 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 254 (A254T)
Ref Sequence ENSEMBL: ENSMUSP00000072264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005477] [ENSMUST00000072438]
Predicted Effect probably benign
Transcript: ENSMUST00000005477
AA Change: A254T

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000005477
Gene: ENSMUSG00000030483
AA Change: A254T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 497 4.1e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072438
AA Change: A254T

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072264
Gene: ENSMUSG00000030483
AA Change: A254T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2e-152 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144140
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP2B6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize some xenobiotics, such as the anti-cancer drugs cyclophosphamide and ifosphamide. Transcript variants for this gene have been described; however, it has not been resolved whether these transcripts are in fact produced by this gene or by a closely related pseudogene, CYP2B7. Both the gene and the pseudogene are located in the middle of a CYP2A pseudogene found in a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Cyp2b10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Cyp2b10 APN 7 25913937 missense probably damaging 0.99
IGL02341:Cyp2b10 APN 7 25911242 missense probably benign 0.33
IGL02557:Cyp2b10 APN 7 25914881 missense probably benign
R0393:Cyp2b10 UTSW 7 25914934 splice site probably benign
R0569:Cyp2b10 UTSW 7 25897735 missense probably damaging 1.00
R1035:Cyp2b10 UTSW 7 25917048 missense probably benign 0.34
R1262:Cyp2b10 UTSW 7 25915411 missense probably benign 0.16
R1282:Cyp2b10 UTSW 7 25926080 missense probably damaging 1.00
R1452:Cyp2b10 UTSW 7 25925388 intron probably benign
R2163:Cyp2b10 UTSW 7 25925385 intron probably benign
R4520:Cyp2b10 UTSW 7 25911557 missense probably benign 0.05
R4831:Cyp2b10 UTSW 7 25915496 nonsense probably null
R5201:Cyp2b10 UTSW 7 25916994 missense probably damaging 1.00
R5330:Cyp2b10 UTSW 7 25913989 nonsense probably null
R5586:Cyp2b10 UTSW 7 25917012 missense probably damaging 1.00
R5964:Cyp2b10 UTSW 7 25926223 missense probably benign 0.28
R6043:Cyp2b10 UTSW 7 25917339 missense probably damaging 0.99
R6470:Cyp2b10 UTSW 7 25911656 missense possibly damaging 0.57
R6991:Cyp2b10 UTSW 7 25917355 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGTGCTGATAGCTCCAGGTGAC -3'
(R):5'- TCTGGACATTACTCAGCCCCAGAC -3'

Sequencing Primer
(F):5'- CAGGTGACCTCCTGGGC -3'
(R):5'- GCCCCAGACAGTATCCCTTG -3'
Posted On2013-05-09