Incidental Mutation 'R4453:Hspa1a'
ID329063
Institutional Source Beutler Lab
Gene Symbol Hspa1a
Ensembl Gene ENSMUSG00000091971
Gene Nameheat shock protein 1A
SynonymsHsp70.3, Hsp70-3
MMRRC Submission 041152-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4453 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34969190-34972156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34970293 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 545 (Y545H)
Ref Sequence ENSEMBL: ENSMUSP00000084586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000087328] [ENSMUST00000173680]
Predicted Effect probably benign
Transcript: ENSMUST00000007248
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087328
AA Change: Y545H

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084586
Gene: ENSMUSG00000091971
AA Change: Y545H

DomainStartEndE-ValueType
Pfam:HSP70 6 612 1.3e-268 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173680
SMART Domains Protein: ENSMUSP00000133726
Gene: ENSMUSG00000092609

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
internal_repeat_1 91 102 5.9e-5 PROSPERO
internal_repeat_1 113 124 5.9e-5 PROSPERO
low complexity region 134 146 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: At the cellular level, mice homozygous for a knock-out allele exhibit impaired thermotolerance and increased sensitivity to heat stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 A G 1: 93,394,353 D361G probably damaging Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Ccdc86 G T 19: 10,948,519 P239T probably damaging Het
Ces2h G A 8: 105,014,656 probably null Het
Ckap5 T A 2: 91,548,845 S43R probably damaging Het
Cpne6 G A 14: 55,512,597 V62M probably damaging Het
Dmbt1 T C 7: 131,040,934 C161R probably damaging Het
Dnajc10 T C 2: 80,346,623 S641P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Grm2 G A 9: 106,653,879 T137I probably damaging Het
Gusb A G 5: 129,998,483 V327A possibly damaging Het
Helz C T 11: 107,672,629 Q1631* probably null Het
Hus1 A T 11: 9,006,035 M166K probably damaging Het
Kcnh1 C A 1: 192,505,517 T762K probably damaging Het
Limd1 C A 9: 123,480,294 Q353K possibly damaging Het
Lipe T A 7: 25,397,690 K276I probably damaging Het
Ntpcr G A 8: 125,736,190 V49I probably benign Het
Olfr814 T C 10: 129,874,661 N32S probably null Het
Ppp1r1c A G 2: 79,708,231 I20V possibly damaging Het
Prdm13 G T 4: 21,679,464 A342E unknown Het
Prkd3 C A 17: 78,983,546 R180L probably damaging Het
Prune2 T C 19: 17,121,910 F1593L probably benign Het
Rims2 T A 15: 39,292,208 C95S probably damaging Het
Stard9 A G 2: 120,697,791 M1510V probably benign Het
Taf12 A G 4: 132,282,995 I92V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tssk5 G A 15: 76,374,543 R48C probably benign Het
Wwtr1 T C 3: 57,575,259 probably null Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zfp473 T A 7: 44,733,254 T552S probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Hspa1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Hspa1a APN 17 34970524 missense probably damaging 1.00
IGL03380:Hspa1a APN 17 34970277 missense probably benign 0.17
R1983:Hspa1a UTSW 17 34970962 missense probably benign 0.01
R2117:Hspa1a UTSW 17 34970479 missense probably damaging 1.00
R3825:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3905:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3906:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3908:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3909:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R4301:Hspa1a UTSW 17 34970506 missense probably benign 0.11
R4610:Hspa1a UTSW 17 34971180 missense probably damaging 0.96
R4904:Hspa1a UTSW 17 34970451 missense probably damaging 1.00
R6253:Hspa1a UTSW 17 34970550 missense probably damaging 1.00
R6366:Hspa1a UTSW 17 34970524 missense probably damaging 1.00
R6478:Hspa1a UTSW 17 34970306 missense probably damaging 1.00
R6981:Hspa1a UTSW 17 34970291 splice site probably null
Predicted Primers PCR Primer
(F):5'- AATCCACCTCCTCGATGGTG -3'
(R):5'- AGATCGAGGTGACCTTCGAC -3'

Sequencing Primer
(F):5'- ACTGATGATGGGGCTGCAC -3'
(R):5'- CGGCATCCTGAACGTCAC -3'
Posted On2015-07-21