Incidental Mutation 'R4553:Kif3a'
ID341786
Institutional Source Beutler Lab
Gene Symbol Kif3a
Ensembl Gene ENSMUSG00000018395
Gene Namekinesin family member 3A
SynonymsKns3, kinesin-II subunit, N-4 kinesin, Kif3, Kifl
MMRRC Submission 041595-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4553 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53567379-53601967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53578918 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 119 (L119I)
Ref Sequence ENSEMBL: ENSMUSP00000113848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057330] [ENSMUST00000118353] [ENSMUST00000120613] [ENSMUST00000132496] [ENSMUST00000173744]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057330
AA Change: L119I

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056197
Gene: ENSMUSG00000018395
AA Change: L119I

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
coiled coil region 416 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118353
AA Change: L119I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113848
Gene: ENSMUSG00000018395
AA Change: L119I

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 418 N/A INTRINSIC
coiled coil region 443 620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120613
AA Change: L119I

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112782
Gene: ENSMUSG00000018395
AA Change: L119I

DomainStartEndE-ValueType
KISc 12 353 4.6e-189 SMART
coiled coil region 354 383 N/A INTRINSIC
coiled coil region 419 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132496
AA Change: L118I

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115161
Gene: ENSMUSG00000018395
AA Change: L118I

DomainStartEndE-ValueType
KISc 11 178 4.96e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140359
Predicted Effect possibly damaging
Transcript: ENSMUST00000173744
AA Change: L119I

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133432
Gene: ENSMUSG00000018395
AA Change: L119I

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 406 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
low complexity region 498 526 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mutations result in embryonic lethality, failure to synthesize cilia in the embryonic node, randomization of left-right asymmetry and structural abnormalities of the neural tube, pericardium, branchial arches, and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,813,193 Y49C probably damaging Het
Adat1 T C 8: 111,990,280 T32A probably damaging Het
Adra2a T C 19: 54,046,735 V174A possibly damaging Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
Cand2 C A 6: 115,792,211 R661S probably damaging Het
Cd274 T C 19: 29,380,448 V180A probably benign Het
Crat T C 2: 30,408,217 T157A probably benign Het
Cts6 G A 13: 61,197,593 P230L probably damaging Het
Dppa2 A G 16: 48,310,514 Y3C possibly damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Fam71f2 A G 6: 29,287,706 I210M probably benign Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Hgfac T A 5: 35,042,856 C130S probably damaging Het
Ifi35 T C 11: 101,457,891 V188A probably damaging Het
Iqsec2 A G X: 152,211,281 H585R probably benign Het
Itih4 T C 14: 30,900,953 L842P probably damaging Het
Lrp2 T C 2: 69,513,285 D910G probably benign Het
Lyve1 T C 7: 110,852,360 probably null Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Mx2 A G 16: 97,552,005 T398A possibly damaging Het
Nlrp4e T C 7: 23,320,979 M297T probably benign Het
Nog A G 11: 89,301,422 L200P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Phf11b G A 14: 59,341,285 P11S probably benign Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Pld1 G T 3: 28,124,702 R915L probably benign Het
Sell C T 1: 164,072,116 T34I probably benign Het
Slc34a1 G A 13: 55,412,061 probably null Het
Slc8b1 T C 5: 120,529,598 V432A probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Xab2 T C 8: 3,611,015 T700A probably benign Het
Other mutations in Kif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Kif3a APN 11 53593523 missense possibly damaging 0.53
IGL01862:Kif3a APN 11 53570541 missense possibly damaging 0.63
IGL02411:Kif3a APN 11 53570698 missense probably damaging 1.00
R0049:Kif3a UTSW 11 53590733 splice site probably benign
R0049:Kif3a UTSW 11 53590733 splice site probably benign
R0078:Kif3a UTSW 11 53578985 missense probably benign 0.22
R0131:Kif3a UTSW 11 53586916 missense possibly damaging 0.53
R1079:Kif3a UTSW 11 53570581 missense possibly damaging 0.87
R1168:Kif3a UTSW 11 53598312 missense probably damaging 1.00
R1554:Kif3a UTSW 11 53598327 missense probably damaging 0.98
R1817:Kif3a UTSW 11 53598734 missense probably damaging 1.00
R2022:Kif3a UTSW 11 53570581 missense probably damaging 1.00
R2964:Kif3a UTSW 11 53578930 missense probably damaging 1.00
R3861:Kif3a UTSW 11 53597978 missense probably benign 0.33
R3928:Kif3a UTSW 11 53570614 missense probably benign 0.02
R5158:Kif3a UTSW 11 53588751 missense probably benign
R5437:Kif3a UTSW 11 53598726 missense probably damaging 0.99
R6621:Kif3a UTSW 11 53579130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATGTTGGTACTAAAGGCCAAAC -3'
(R):5'- CCTGTAAGGACAATGGTGGAAC -3'

Sequencing Primer
(F):5'- AGAGTCTTACTATGTAGCCCAGGC -3'
(R):5'- TGGAACACTCAATGTCTGAAAAGTG -3'
Posted On2015-09-24