Incidental Mutation 'R5158:Kif3a'
ID396842
Institutional Source Beutler Lab
Gene Symbol Kif3a
Ensembl Gene ENSMUSG00000018395
Gene Namekinesin family member 3A
SynonymsKns3, kinesin-II subunit, N-4 kinesin, Kif3, Kifl
MMRRC Submission 042740-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5158 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53567379-53601967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53588751 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 430 (F430L)
Ref Sequence ENSEMBL: ENSMUSP00000113848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057330] [ENSMUST00000118353] [ENSMUST00000120613] [ENSMUST00000173744]
Predicted Effect probably benign
Transcript: ENSMUST00000057330
SMART Domains Protein: ENSMUSP00000056197
Gene: ENSMUSG00000018395

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
coiled coil region 416 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118353
AA Change: F430L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113848
Gene: ENSMUSG00000018395
AA Change: F430L

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 418 N/A INTRINSIC
coiled coil region 443 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120613
SMART Domains Protein: ENSMUSP00000112782
Gene: ENSMUSG00000018395

DomainStartEndE-ValueType
KISc 12 353 4.6e-189 SMART
coiled coil region 354 383 N/A INTRINSIC
coiled coil region 419 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132653
Predicted Effect probably benign
Transcript: ENSMUST00000173744
SMART Domains Protein: ENSMUSP00000133432
Gene: ENSMUSG00000018395

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 406 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
low complexity region 498 526 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mutations result in embryonic lethality, failure to synthesize cilia in the embryonic node, randomization of left-right asymmetry and structural abnormalities of the neural tube, pericardium, branchial arches, and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,514,829 T357I probably benign Het
Abca14 A T 7: 120,253,429 R872S probably benign Het
Adnp2 A G 18: 80,137,543 Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 N327S probably damaging Het
Ccdc190 A G 1: 169,933,009 R69G probably benign Het
Cfap54 T C 10: 93,065,197 D213G probably damaging Het
Clcn4 G A 7: 7,291,619 T381I possibly damaging Het
Cobl A G 11: 12,256,198 F477S possibly damaging Het
Ctdspl2 T A 2: 121,981,293 V205E probably benign Het
Dhx37 A T 5: 125,415,152 Y1128N probably damaging Het
Ehmt2 G A 17: 34,911,664 E1085K probably damaging Het
Fam149a T G 8: 45,350,435 I340L possibly damaging Het
Fut9 T A 4: 25,620,731 I28F probably benign Het
Il1f9 T A 2: 24,192,786 I191K probably damaging Het
Iqgap1 T C 7: 80,743,068 N716D probably benign Het
Itgb7 T C 15: 102,217,029 D672G probably benign Het
Kat6b A G 14: 21,669,986 M1469V possibly damaging Het
L3mbtl3 T C 10: 26,303,688 D523G unknown Het
Mcf2l A G 8: 13,009,715 Q736R probably damaging Het
Mpl T G 4: 118,456,684 D128A probably damaging Het
Myom3 T A 4: 135,765,586 C149S probably damaging Het
N4bp2 A G 5: 65,808,462 I1285V probably damaging Het
Nalcn T C 14: 123,515,737 Q279R probably damaging Het
Ndc1 T G 4: 107,375,165 S182R probably damaging Het
Ngf A T 3: 102,520,129 M65L possibly damaging Het
Olfr134 T A 17: 38,175,454 Y123* probably null Het
Pigb T C 9: 73,022,401 Y300C probably damaging Het
Pla2g2a T G 4: 138,833,284 *69G probably null Het
Ppp1r12b T C 1: 134,886,428 E379G probably damaging Het
Ptdss2 T C 7: 141,151,771 F164S probably benign Het
Ptprc T C 1: 138,175,084 T2A possibly damaging Het
Ptprq T A 10: 107,534,704 N2042I probably damaging Het
Rdh10 A T 1: 16,107,997 R164S probably damaging Het
Sec31a A T 5: 100,393,321 I309N probably damaging Het
Skint5 A T 4: 113,742,212 I710N unknown Het
Slc25a30 A T 14: 75,771,516 L26Q probably damaging Het
Sptan1 G A 2: 29,978,443 V34I probably damaging Het
Sult1e1 A T 5: 87,587,594 I75N probably damaging Het
Trpa1 A G 1: 14,881,661 V938A probably benign Het
Vps16 C T 2: 130,441,279 R531C probably damaging Het
Zbtb22 C T 17: 33,918,449 H523Y probably damaging Het
Zfp39 G A 11: 58,889,845 T697M possibly damaging Het
Other mutations in Kif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Kif3a APN 11 53593523 missense possibly damaging 0.53
IGL01862:Kif3a APN 11 53570541 missense possibly damaging 0.63
IGL02411:Kif3a APN 11 53570698 missense probably damaging 1.00
R0049:Kif3a UTSW 11 53590733 splice site probably benign
R0049:Kif3a UTSW 11 53590733 splice site probably benign
R0078:Kif3a UTSW 11 53578985 missense probably benign 0.22
R0131:Kif3a UTSW 11 53586916 missense possibly damaging 0.53
R1079:Kif3a UTSW 11 53570581 missense possibly damaging 0.87
R1168:Kif3a UTSW 11 53598312 missense probably damaging 1.00
R1554:Kif3a UTSW 11 53598327 missense probably damaging 0.98
R1817:Kif3a UTSW 11 53598734 missense probably damaging 1.00
R2022:Kif3a UTSW 11 53570581 missense probably damaging 1.00
R2964:Kif3a UTSW 11 53578930 missense probably damaging 1.00
R3861:Kif3a UTSW 11 53597978 missense probably benign 0.33
R3928:Kif3a UTSW 11 53570614 missense probably benign 0.02
R4553:Kif3a UTSW 11 53578918 missense possibly damaging 0.93
R5437:Kif3a UTSW 11 53598726 missense probably damaging 0.99
R6621:Kif3a UTSW 11 53579130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCGCGCTTGAATGCAAAG -3'
(R):5'- TCTCCCACTGTCTCAAACATAGG -3'

Sequencing Primer
(F):5'- CGCTTGAATGCAAAGCTTCAGTG -3'
(R):5'- ACTGTCTCAAACATAGGCTCTGG -3'
Posted On2016-06-21