Incidental Mutation 'R4615:Abca12'
ID344995
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene NameATP-binding cassette, sub-family A (ABC1), member 12
Synonyms4833417A11Rik, 4832428G11Rik
MMRRC Submission 041826-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location71242276-71414910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71330334 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 363 (I363V)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
Predicted Effect probably benign
Transcript: ENSMUST00000087268
AA Change: I363V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: I363V

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191520
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTTCAGCTGACCATGCGG -3'
(R):5'- AAGTAGCTCTTATGGTTGAGGTAGC -3'

Sequencing Primer
(F):5'- ACCATGCGGTGCAAGCAG -3'
(R):5'- CACATTCAGAGGTGTGCTGC -3'
Posted On2015-09-25