Incidental Mutation 'R4623:Arsj'
ID346304
Institutional Source Beutler Lab
Gene Symbol Arsj
Ensembl Gene ENSMUSG00000046561
Gene Namearylsulfatase J
Synonyms9330196J05Rik
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4623 (G1)
Quality Score210
Status Validated
Chromosome3
Chromosomal Location126363684-126440375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126364796 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 8 (E8V)
Ref Sequence ENSEMBL: ENSMUSP00000091511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093976]
Predicted Effect probably benign
Transcript: ENSMUST00000093976
AA Change: E8V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091511
Gene: ENSMUSG00000046561
AA Change: E8V

DomainStartEndE-ValueType
Pfam:Sulfatase 74 388 8.4e-68 PFAM
low complexity region 554 582 N/A INTRINSIC
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfatases (EC 3.1.5.6), such as ARSJ, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cts6 A T 13: 61,202,160 Y36N possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dock3 T C 9: 107,062,045 E168G possibly damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Dusp13 A C 14: 21,743,478 probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Ikzf4 A G 10: 128,641,119 C108R probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr784 G A 10: 129,388,046 V138M probably benign Het
Pde8b C T 13: 95,041,939 A566T possibly damaging Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Proc T A 18: 32,127,473 T200S probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vav1 C A 17: 57,299,839 probably null Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Arsj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Arsj APN 3 126364945 missense probably benign 0.00
IGL01150:Arsj APN 3 126438784 missense probably benign
IGL01337:Arsj APN 3 126365114 missense probably damaging 1.00
IGL01446:Arsj APN 3 126438814 missense probably benign 0.01
IGL01484:Arsj APN 3 126365036 missense probably damaging 1.00
IGL02479:Arsj APN 3 126438939 missense possibly damaging 0.91
IGL03149:Arsj APN 3 126439404 utr 3 prime probably benign
R0552:Arsj UTSW 3 126439344 missense probably benign 0.01
R0690:Arsj UTSW 3 126438184 missense probably damaging 0.99
R1809:Arsj UTSW 3 126438295 missense possibly damaging 0.87
R1881:Arsj UTSW 3 126438837 missense probably damaging 1.00
R1940:Arsj UTSW 3 126438346 missense probably damaging 1.00
R1957:Arsj UTSW 3 126439021 missense probably benign 0.08
R2156:Arsj UTSW 3 126438688 missense probably damaging 1.00
R2969:Arsj UTSW 3 126439372 missense probably benign 0.01
R3432:Arsj UTSW 3 126364975 missense probably benign 0.00
R4826:Arsj UTSW 3 126438802 missense probably damaging 1.00
R4955:Arsj UTSW 3 126438540 missense probably benign 0.15
R5134:Arsj UTSW 3 126438154 missense probably benign
R5164:Arsj UTSW 3 126438159 missense probably benign 0.00
R5468:Arsj UTSW 3 126438388 missense possibly damaging 0.52
R5664:Arsj UTSW 3 126438657 missense probably damaging 1.00
R6136:Arsj UTSW 3 126364775 start codon destroyed probably null 0.07
X0022:Arsj UTSW 3 126364966 missense possibly damaging 0.52
Z1088:Arsj UTSW 3 126439132 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GAGGACATCTGCTCCCTTCTAG -3'
(R):5'- CAGGTCTCTCATCAACTTGAGC -3'

Sequencing Primer
(F):5'- TGAGTTAAACCGTTACCTCCAGAG -3'
(R):5'- AACTTGAGCTTTTAGGGACCC -3'
Posted On2015-09-25