Incidental Mutation 'R4623:Vav1'
ID346372
Institutional Source Beutler Lab
Gene Symbol Vav1
Ensembl Gene ENSMUSG00000034116
Gene Namevav 1 oncogene
Synonyms
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R4623 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location57279100-57328031 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 57299839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005889] [ENSMUST00000112870] [ENSMUST00000169220]
Predicted Effect probably null
Transcript: ENSMUST00000005889
SMART Domains Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 669 751 8.88e-25 SMART
SH3 785 841 1.44e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112870
SMART Domains Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 633 712 3.93e-2 SMART
SH3 746 802 1.44e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169220
SMART Domains Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 27 79 6.2e-11 PFAM
RhoGEF 174 348 7.89e-62 SMART
PH 379 482 8.45e-12 SMART
C1 492 540 3.67e-9 SMART
SH3 571 635 1.65e-8 SMART
SH2 645 727 8.88e-25 SMART
SH3 761 817 1.44e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174878
Meta Mutation Damage Score 0.6024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Arsj A T 3: 126,364,796 E8V probably benign Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cts6 A T 13: 61,202,160 Y36N possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dock3 T C 9: 107,062,045 E168G possibly damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Dusp13 A C 14: 21,743,478 probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Ikzf4 A G 10: 128,641,119 C108R probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr784 G A 10: 129,388,046 V138M probably benign Het
Pde8b C T 13: 95,041,939 A566T possibly damaging Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Proc T A 18: 32,127,473 T200S probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Vav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Vav1 APN 17 57299176 missense probably benign 0.21
IGL01613:Vav1 APN 17 57307067 missense possibly damaging 0.93
IGL02032:Vav1 APN 17 57297090 missense possibly damaging 0.91
IGL02213:Vav1 APN 17 57305351 missense possibly damaging 0.84
IGL03009:Vav1 APN 17 57296582 missense probably benign 0.38
Belated UTSW 17 57301214 missense probably benign 0.06
Delayed UTSW 17 57296552 missense probably damaging 1.00
finally UTSW 17 57311860 nonsense probably null
last UTSW 17 57296039 missense probably damaging 0.99
Late UTSW 17 57301870 missense possibly damaging 0.91
Plain_sight UTSW 17 57297122 missense probably damaging 1.00
tardive UTSW 17 57303079 nonsense probably null
R0116:Vav1 UTSW 17 57296039 missense probably damaging 0.99
R0125:Vav1 UTSW 17 57299847 missense probably damaging 1.00
R0268:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0344:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0579:Vav1 UTSW 17 57279271 missense probably benign 0.01
R0634:Vav1 UTSW 17 57303862 missense probably benign 0.00
R1313:Vav1 UTSW 17 57309498 splice site probably benign
R1345:Vav1 UTSW 17 57301214 missense probably benign 0.06
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1579:Vav1 UTSW 17 57297252 missense probably benign 0.05
R1872:Vav1 UTSW 17 57324750 missense probably damaging 1.00
R1971:Vav1 UTSW 17 57327697 missense probably damaging 1.00
R2197:Vav1 UTSW 17 57303140 missense probably benign 0.37
R2903:Vav1 UTSW 17 57306187 missense probably benign 0.05
R4753:Vav1 UTSW 17 57306140 missense probably damaging 0.98
R4779:Vav1 UTSW 17 57296552 missense probably damaging 1.00
R5232:Vav1 UTSW 17 57303846 missense possibly damaging 0.81
R5240:Vav1 UTSW 17 57297122 missense probably damaging 1.00
R5503:Vav1 UTSW 17 57303079 nonsense probably null
R5592:Vav1 UTSW 17 57304835 missense probably benign 0.00
R5782:Vav1 UTSW 17 57296001 missense probably damaging 1.00
R5945:Vav1 UTSW 17 57301870 missense possibly damaging 0.91
R6113:Vav1 UTSW 17 57301884 missense probably benign 0.00
R6514:Vav1 UTSW 17 57327660 missense probably damaging 1.00
R6575:Vav1 UTSW 17 57305280 missense probably damaging 0.97
R6932:Vav1 UTSW 17 57302330 missense possibly damaging 0.92
R7024:Vav1 UTSW 17 57279268 missense probably damaging 1.00
R7063:Vav1 UTSW 17 57311860 nonsense probably null
R7322:Vav1 UTSW 17 57302266 missense probably benign
R7335:Vav1 UTSW 17 57296720 missense probably benign
R7474:Vav1 UTSW 17 57299102 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGGCTGTATTCTGCACTCTACC -3'
(R):5'- GCATGGACCATGGATGTACAC -3'

Sequencing Primer
(F):5'- GCTGTATTCTGCACTCTACCATTAAC -3'
(R):5'- TGTACACATACATGCTTGCACATAC -3'
Posted On2015-09-25