Incidental Mutation 'R4646:Grm6'
ID350266
Institutional Source Beutler Lab
Gene Symbol Grm6
Ensembl Gene ENSMUSG00000000617
Gene Nameglutamate receptor, metabotropic 6
Synonymsnerg1, nob2, mGluR6, nob3
MMRRC Submission 041907-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4646 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50850685-50866208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50857206 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 381 (E381G)
Ref Sequence ENSEMBL: ENSMUSP00000130728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000631] [ENSMUST00000171427]
Predicted Effect probably benign
Transcript: ENSMUST00000000631
AA Change: E381G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000000631
Gene: ENSMUSG00000000617
AA Change: E381G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 132 475 1.7e-11 PFAM
Pfam:NCD3G 508 558 5.3e-16 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 589 837 7.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156890
Predicted Effect probably benign
Transcript: ENSMUST00000171427
AA Change: E381G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130728
Gene: ENSMUSG00000000617
AA Change: E381G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 2.5e-106 PFAM
Pfam:Peripla_BP_6 132 338 6.2e-10 PFAM
Pfam:NCD3G 508 558 4e-13 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 591 836 1.4e-56 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice show loss of ON responses without significant alteration of OFF responses in visual transmission or changes in visual behavioral responses. ENU-induced mutant mice have an ERG that lacks the rod b-wave and scotopic threshold response, while the cone ERG is of large amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
Acadl A T 1: 66,831,443 S428R probably benign Het
Adamts10 A G 17: 33,545,555 D683G probably damaging Het
Angptl4 G A 17: 33,781,299 P32S probably benign Het
Apob A G 12: 8,012,759 N134S probably benign Het
Atr G A 9: 95,871,197 probably null Het
B4galnt1 G A 10: 127,167,836 V223M probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C2cd3 A C 7: 100,372,450 probably benign Het
Clca4b A C 3: 144,928,525 H102Q probably benign Het
Cntrl T C 2: 35,149,461 I557T probably damaging Het
Col26a1 G A 5: 136,847,550 S72F probably damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Csmd1 T C 8: 15,932,511 I2719V possibly damaging Het
Cul9 C T 17: 46,539,017 W502* probably null Het
Dazl A T 17: 50,288,155 F84I probably damaging Het
Dcaf1 G T 9: 106,846,807 R478L probably benign Het
Dock5 T G 14: 67,842,779 I198L probably benign Het
Dock9 A T 14: 121,586,246 L1428H probably damaging Het
Dync1li1 T A 9: 114,709,169 V198E probably damaging Het
E130309D02Rik A T 5: 143,307,985 W246R probably damaging Het
Egf A T 3: 129,720,276 C429S probably damaging Het
Ehmt1 T C 2: 24,891,684 E7G probably null Het
Ercc4 G T 16: 13,147,574 R690L probably damaging Het
Erich5 T C 15: 34,470,966 C114R possibly damaging Het
Etv1 T C 12: 38,865,686 S428P possibly damaging Het
Fam19a5 T G 15: 87,720,582 S115A probably damaging Het
Fbxo31 G T 8: 121,560,016 F174L probably benign Het
Fbxo33 T A 12: 59,204,431 I433L probably benign Het
Fez2 A T 17: 78,412,928 V99E probably damaging Het
Gabarapl2 A C 8: 111,942,553 K48Q probably damaging Het
Gfi1b T A 2: 28,610,137 H294L probably damaging Het
Gk2 A G 5: 97,456,197 S261P probably damaging Het
Gm7534 G A 4: 134,202,148 A282V probably benign Het
Gpr158 T C 2: 21,827,053 I988T probably benign Het
Grk3 G C 5: 112,929,720 H394D probably benign Het
Gtf3c1 A T 7: 125,659,094 M1268K possibly damaging Het
Hikeshi A T 7: 89,923,646 I113N probably damaging Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Hunk C A 16: 90,475,903 T365K probably damaging Het
Kdm5a T G 6: 120,374,977 V176G possibly damaging Het
Kif2a T A 13: 106,962,185 E691V probably damaging Het
Ly6e T C 15: 74,958,661 probably null Het
Map1b G T 13: 99,432,469 P1248Q unknown Het
Mettl25 A G 10: 105,826,555 S185P probably damaging Het
Mfap3l T A 8: 60,671,150 V142D probably damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mkx G A 18: 6,992,040 T280I probably benign Het
Msi1 A T 5: 115,451,455 probably null Het
Muc5b A G 7: 141,862,640 M3108V probably benign Het
Mybl1 A G 1: 9,672,286 S625P probably damaging Het
Myo7b C A 18: 31,994,369 V627F probably benign Het
Ndst3 A T 3: 123,672,035 I96N probably damaging Het
Nrp1 A T 8: 128,457,944 T357S probably benign Het
Obscn G T 11: 59,124,570 Y1050* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1386 A C 11: 49,470,624 I158L probably benign Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Olfr320 A G 11: 58,684,730 N286D probably damaging Het
Olfr710 A T 7: 106,944,340 N220K probably benign Het
Olfr74 A T 2: 87,973,798 I289K probably benign Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Pick1 A T 15: 79,248,937 D399V probably benign Het
Pik3c2g T A 6: 139,720,018 S22T probably benign Het
Pnpla2 A G 7: 141,458,661 E276G possibly damaging Het
Pomk A T 8: 25,983,605 S107T probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rimbp3 A G 16: 17,213,098 D1462G probably damaging Het
Rnf112 T A 11: 61,452,110 E230V probably damaging Het
Rock1 T C 18: 10,112,391 T455A probably benign Het
Rtp4 A T 16: 23,610,040 M18L probably benign Het
Scaf11 A T 15: 96,420,100 probably null Het
Schip1 T C 3: 68,064,964 V8A probably benign Het
Sec31b T C 19: 44,526,621 H351R probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Soga1 T C 2: 157,020,506 E1501G probably damaging Het
Sowahb T C 5: 93,042,856 D668G probably damaging Het
Spam1 A G 6: 24,800,587 T442A probably benign Het
Syt14 T A 1: 192,933,325 Y451F probably damaging Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Thbs1 G A 2: 118,118,329 A489T probably benign Het
Tnfaip1 C T 11: 78,529,182 R88Q probably damaging Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trim55 T C 3: 19,671,122 F268L probably benign Het
Trmt112 T A 19: 6,910,448 V55E possibly damaging Het
Tube1 A G 10: 39,142,367 M147V possibly damaging Het
Ubn1 A G 16: 5,077,987 T966A probably damaging Het
Unc80 A G 1: 66,669,235 I2651V probably benign Het
Vmn1r172 G A 7: 23,660,494 R268H probably benign Het
Vmn1r231 T A 17: 20,890,309 I115F probably damaging Het
Vmn1r237 A G 17: 21,314,138 K41R probably benign Het
Vmn2r58 A T 7: 41,860,511 N547K probably damaging Het
Vmn2r74 T C 7: 85,957,574 D188G probably benign Het
Vwa5b2 A G 16: 20,596,329 K367R probably damaging Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Wbp11 T A 6: 136,821,191 Y236F probably benign Het
Wbp4 T A 14: 79,472,361 I145F possibly damaging Het
Wwc2 C A 8: 47,920,601 D77Y probably damaging Het
Other mutations in Grm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Grm6 APN 11 50863297 splice site probably benign
IGL01305:Grm6 APN 11 50859519 missense probably benign 0.27
IGL02121:Grm6 APN 11 50859656 missense probably damaging 1.00
IGL02413:Grm6 APN 11 50859939 missense probably damaging 0.99
ANU22:Grm6 UTSW 11 50859519 missense probably benign 0.27
R0089:Grm6 UTSW 11 50859965 missense probably damaging 1.00
R0135:Grm6 UTSW 11 50853223 missense probably damaging 0.99
R0147:Grm6 UTSW 11 50859317 missense possibly damaging 0.89
R1498:Grm6 UTSW 11 50857256 missense probably damaging 1.00
R1577:Grm6 UTSW 11 50863145 missense probably damaging 1.00
R1666:Grm6 UTSW 11 50859884 missense probably damaging 1.00
R2923:Grm6 UTSW 11 50864521 missense probably damaging 1.00
R4060:Grm6 UTSW 11 50853224 missense probably damaging 1.00
R4486:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4488:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4489:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4701:Grm6 UTSW 11 50863010 missense probably damaging 1.00
R4785:Grm6 UTSW 11 50857277 missense probably benign 0.00
R4860:Grm6 UTSW 11 50864612 missense probably benign 0.31
R5603:Grm6 UTSW 11 50856959 missense probably damaging 1.00
R6104:Grm6 UTSW 11 50859317 missense possibly damaging 0.89
R6746:Grm6 UTSW 11 50856963 missense probably damaging 1.00
R6791:Grm6 UTSW 11 50859774 missense possibly damaging 0.74
R6802:Grm6 UTSW 11 50853389 missense probably benign 0.24
R6856:Grm6 UTSW 11 50859825 missense probably damaging 1.00
R7102:Grm6 UTSW 11 50862977 missense possibly damaging 0.87
R7221:Grm6 UTSW 11 50863043 missense probably damaging 0.97
X0025:Grm6 UTSW 11 50863095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTTCCCTGGAGAACAACC -3'
(R):5'- ACTCACCATTGAAGCGGACTG -3'

Sequencing Primer
(F):5'- GTTCTGGGAAGAGAATTTTAACTGC -3'
(R):5'- CTGCTCGGATGTAGTGCAGC -3'
Posted On2015-10-08