Incidental Mutation 'R0135:Grm6'
ID21892
Institutional Source Beutler Lab
Gene Symbol Grm6
Ensembl Gene ENSMUSG00000000617
Gene Nameglutamate receptor, metabotropic 6
Synonymsnerg1, nob2, mGluR6, nob3
MMRRC Submission 038420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0135 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location50850685-50866208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50853223 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 174 (E174K)
Ref Sequence ENSEMBL: ENSMUSP00000130728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000631] [ENSMUST00000171427]
Predicted Effect probably damaging
Transcript: ENSMUST00000000631
AA Change: E174K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000631
Gene: ENSMUSG00000000617
AA Change: E174K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 132 475 1.7e-11 PFAM
Pfam:NCD3G 508 558 5.3e-16 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 589 837 7.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156890
Predicted Effect probably damaging
Transcript: ENSMUST00000171427
AA Change: E174K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130728
Gene: ENSMUSG00000000617
AA Change: E174K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 2.5e-106 PFAM
Pfam:Peripla_BP_6 132 338 6.2e-10 PFAM
Pfam:NCD3G 508 558 4e-13 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 591 836 1.4e-56 PFAM
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice show loss of ON responses without significant alteration of OFF responses in visual transmission or changes in visual behavioral responses. ENU-induced mutant mice have an ERG that lacks the rod b-wave and scotopic threshold response, while the cone ERG is of large amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T C 7: 34,245,957 I499M probably damaging Het
4932438H23Rik A G 16: 91,055,627 F207S probably damaging Het
Abhd8 T A 8: 71,458,074 K363N probably benign Het
Adam11 T A 11: 102,776,573 V653E probably damaging Het
Adam18 T C 8: 24,665,542 S154G possibly damaging Het
Adamts1 T C 16: 85,798,703 probably benign Het
Afm G T 5: 90,550,322 V528L probably benign Het
Alox12b C T 11: 69,162,748 H145Y probably benign Het
Ankmy2 C A 12: 36,170,435 probably benign Het
Aox3 G A 1: 58,125,088 probably benign Het
Arhgap28 T C 17: 67,864,588 D396G probably damaging Het
B430203G13Rik T C 12: 17,924,488 noncoding transcript Het
Bean1 C T 8: 104,217,175 P121S probably damaging Het
Bok T C 1: 93,686,507 S21P probably damaging Het
Brwd1 A C 16: 96,047,104 N572K probably damaging Het
C5ar1 A T 7: 16,248,939 V52E probably damaging Het
Cdr2l C A 11: 115,393,671 P278T probably damaging Het
Cnga4 T A 7: 105,406,848 I219N probably damaging Het
Cpne2 C T 8: 94,554,925 probably benign Het
D430041D05Rik A G 2: 104,255,034 S1057P possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dgcr2 A G 16: 17,858,442 S152P probably damaging Het
Dstyk A T 1: 132,462,934 D828V probably damaging Het
Eml2 T C 7: 19,203,952 S582P probably damaging Het
Engase T C 11: 118,484,478 Y359H possibly damaging Het
Fat3 T C 9: 16,006,777 D1450G probably damaging Het
Fbxw8 A T 5: 118,070,487 I467N probably damaging Het
Fhdc1 A T 3: 84,445,618 Y767N probably damaging Het
Flii T C 11: 60,723,378 D105G probably damaging Het
Gaa C T 11: 119,278,890 T590I probably benign Het
Gabrr1 T A 4: 33,160,224 S303T probably damaging Het
Gif G T 19: 11,757,754 C246F probably damaging Het
Glp1r A G 17: 30,924,577 I196V probably benign Het
Gm884 C A 11: 103,618,047 probably benign Het
Helz2 A C 2: 181,232,269 L2144R probably damaging Het
Itpr1 A T 6: 108,488,482 probably benign Het
Kcns1 A T 2: 164,164,955 S363T possibly damaging Het
Kif13a A T 13: 46,793,943 V855E probably damaging Het
Krt42 T C 11: 100,263,159 T424A possibly damaging Het
Lct A T 1: 128,285,123 F1931Y probably damaging Het
Lrp1b A T 2: 41,269,239 V1563E probably damaging Het
Lzts2 T C 19: 45,026,187 probably benign Het
Mamdc4 C T 2: 25,566,920 R615Q possibly damaging Het
Mei1 C T 15: 82,071,969 Q133* probably null Het
Mif4gd T C 11: 115,608,465 E197G probably damaging Het
Ncdn A T 4: 126,746,669 S544T probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Olfr68 T A 7: 103,777,763 D194V probably damaging Het
Padi6 T C 4: 140,737,352 T114A probably benign Het
Pigk G T 3: 152,744,706 probably benign Het
Pkd1 T A 17: 24,565,071 F197Y possibly damaging Het
Pld5 A T 1: 175,970,589 F415I probably damaging Het
Pnpla5 A G 15: 84,113,949 L364P probably damaging Het
Prrc2c G A 1: 162,715,483 probably benign Het
Rab32 C T 10: 10,550,840 D121N probably damaging Het
Rab44 A T 17: 29,138,132 T79S probably benign Het
Reln G T 5: 22,128,649 N258K probably damaging Het
Retsat A G 6: 72,602,772 T177A probably damaging Het
Serpinf2 T A 11: 75,436,393 H236L probably damaging Het
Slc26a6 A T 9: 108,860,595 probably benign Het
Slitrk1 T A 14: 108,911,629 E550V probably benign Het
Smarcd3 A T 5: 24,595,499 probably benign Het
Spdye4a A C 5: 143,225,102 probably null Het
Susd2 C T 10: 75,638,514 G572D probably damaging Het
Tcaf3 C T 6: 42,589,758 R799K probably benign Het
Tg A G 15: 66,694,870 S1256G probably benign Het
Them4 A T 3: 94,323,570 probably benign Het
Tmem210 C T 2: 25,288,468 A47V probably damaging Het
Tnfrsf1b A G 4: 145,229,046 Y47H probably benign Het
Tnik T G 3: 28,607,245 N598K possibly damaging Het
Ttc3 A G 16: 94,462,268 N1498D possibly damaging Het
Ttll4 C A 1: 74,679,928 H313N possibly damaging Het
Vipr2 A G 12: 116,142,827 I348V probably benign Het
Vps13a A G 19: 16,780,765 V2A probably damaging Het
Vps72 G A 3: 95,119,197 R151K probably damaging Het
Zfp106 A G 2: 120,520,487 V1561A probably damaging Het
Zfp658 C A 7: 43,573,595 Y431* probably null Het
Zkscan2 T C 7: 123,480,641 K698E possibly damaging Het
Other mutations in Grm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Grm6 APN 11 50863297 splice site probably benign
IGL01305:Grm6 APN 11 50859519 missense probably benign 0.27
IGL02121:Grm6 APN 11 50859656 missense probably damaging 1.00
IGL02413:Grm6 APN 11 50859939 missense probably damaging 0.99
ANU22:Grm6 UTSW 11 50859519 missense probably benign 0.27
R0089:Grm6 UTSW 11 50859965 missense probably damaging 1.00
R0147:Grm6 UTSW 11 50859317 missense possibly damaging 0.89
R1498:Grm6 UTSW 11 50857256 missense probably damaging 1.00
R1577:Grm6 UTSW 11 50863145 missense probably damaging 1.00
R1666:Grm6 UTSW 11 50859884 missense probably damaging 1.00
R2923:Grm6 UTSW 11 50864521 missense probably damaging 1.00
R4060:Grm6 UTSW 11 50853224 missense probably damaging 1.00
R4486:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4488:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4489:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4646:Grm6 UTSW 11 50857206 missense probably benign 0.03
R4701:Grm6 UTSW 11 50863010 missense probably damaging 1.00
R4785:Grm6 UTSW 11 50857277 missense probably benign 0.00
R4860:Grm6 UTSW 11 50864612 missense probably benign 0.31
R5603:Grm6 UTSW 11 50856959 missense probably damaging 1.00
R6104:Grm6 UTSW 11 50859317 missense possibly damaging 0.89
R6746:Grm6 UTSW 11 50856963 missense probably damaging 1.00
R6791:Grm6 UTSW 11 50859774 missense possibly damaging 0.74
R6802:Grm6 UTSW 11 50853389 missense probably benign 0.24
R6856:Grm6 UTSW 11 50859825 missense probably damaging 1.00
R7102:Grm6 UTSW 11 50862977 missense possibly damaging 0.87
R7221:Grm6 UTSW 11 50863043 missense probably damaging 0.97
X0025:Grm6 UTSW 11 50863095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCTGCATTCACAGATAGCCCAC -3'
(R):5'- GCTTTCACCATAGTTGCCCTCAGAG -3'

Sequencing Primer
(F):5'- GTGTGGCCCTTCCATCTGG -3'
(R):5'- GGCCAGTGTAGACACGTAATTC -3'
Posted On2013-04-12