Incidental Mutation 'R4865:Gas2l3'
ID374849
Institutional Source Beutler Lab
Gene Symbol Gas2l3
Ensembl Gene ENSMUSG00000074802
Gene Namegrowth arrest-specific 2 like 3
Synonyms8430435B07Rik, LOC237436
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R4865 (G1)
Quality Score217
Status Validated
Chromosome10
Chromosomal Location89408823-89443967 bp(-) (GRCm38)
Type of Mutationsmall deletion (3 aa in frame mutation)
DNA Base Change (assembly) CACTCGTCATACT to CACT at 89430958 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099374] [ENSMUST00000105298] [ENSMUST00000218764] [ENSMUST00000219351] [ENSMUST00000220071] [ENSMUST00000220128] [ENSMUST00000220234]
Predicted Effect probably benign
Transcript: ENSMUST00000099374
SMART Domains Protein: ENSMUSP00000096973
Gene: ENSMUSG00000074802

DomainStartEndE-ValueType
CH 52 166 1.71e-9 SMART
low complexity region 179 194 N/A INTRINSIC
Pfam:GAS2 215 284 1.8e-29 PFAM
low complexity region 446 460 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105298
SMART Domains Protein: ENSMUSP00000100935
Gene: ENSMUSG00000074802

DomainStartEndE-ValueType
CH 52 166 1.71e-9 SMART
low complexity region 179 194 N/A INTRINSIC
Pfam:GAS2 213 286 1.5e-31 PFAM
low complexity region 446 460 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219073
Predicted Effect probably benign
Transcript: ENSMUST00000219351
Predicted Effect probably benign
Transcript: ENSMUST00000220071
Predicted Effect probably benign
Transcript: ENSMUST00000220128
Predicted Effect probably benign
Transcript: ENSMUST00000220234
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial postnatal lethality with none surviving past 4 months, dilated cardiomyopathy, cardiac interstitial fibrosis, and premature binucleation of cardiomyocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Ros1 G T 10: 52,172,870 A88E probably damaging Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Gas2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gas2l3 APN 10 89413627 missense probably benign 0.00
IGL01148:Gas2l3 APN 10 89413504 missense probably benign 0.25
R0472:Gas2l3 UTSW 10 89426477 missense probably damaging 1.00
R0578:Gas2l3 UTSW 10 89417075 missense probably damaging 1.00
R0720:Gas2l3 UTSW 10 89413943 missense probably benign 0.00
R1386:Gas2l3 UTSW 10 89414353 missense possibly damaging 0.77
R1470:Gas2l3 UTSW 10 89413934 missense probably benign
R1470:Gas2l3 UTSW 10 89413934 missense probably benign
R1530:Gas2l3 UTSW 10 89433769 missense probably benign 0.02
R1733:Gas2l3 UTSW 10 89414265 missense probably damaging 1.00
R1772:Gas2l3 UTSW 10 89417014 unclassified probably benign
R1840:Gas2l3 UTSW 10 89422251 missense possibly damaging 0.79
R2168:Gas2l3 UTSW 10 89414098 missense probably benign 0.01
R3082:Gas2l3 UTSW 10 89430958 small deletion probably benign
R3083:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4639:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4641:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4642:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4643:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4644:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4645:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4809:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4810:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4820:Gas2l3 UTSW 10 89417045 missense probably damaging 1.00
R4852:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4853:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4855:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4900:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4906:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4926:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4946:Gas2l3 UTSW 10 89413772 missense probably benign
R5072:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5073:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5074:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5137:Gas2l3 UTSW 10 89413975 missense probably damaging 1.00
R5579:Gas2l3 UTSW 10 89414066 missense probably benign
R5919:Gas2l3 UTSW 10 89417055 missense probably damaging 1.00
R6573:Gas2l3 UTSW 10 89422210 splice site probably null
R6763:Gas2l3 UTSW 10 89413369 missense probably benign 0.00
R6961:Gas2l3 UTSW 10 89413291 missense probably benign 0.00
R7491:Gas2l3 UTSW 10 89413901 missense not run
Predicted Primers PCR Primer
(F):5'- CCTGACTCTGACATTCACTGAG -3'
(R):5'- TGACATCAACCACTGTATTCAATGC -3'

Sequencing Primer
(F):5'- ACTGAGTATCCCTGGCATCTGG -3'
(R):5'- ACAATTTTGCTTATTCTGGATGGTC -3'
Posted On2016-03-17