Incidental Mutation 'R4883:Lifr'
ID375462
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Nameleukemia inhibitory factor receptor
SynonymsA230075M04Rik, soluble differentiation-stimulating factor receptor
MMRRC Submission 042491-MU
Accession Numbers

Genbank: NM_013584; MGI: 96788  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4883 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location7090614-7197489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7185625 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 738 (K738E)
Ref Sequence ENSEMBL: ENSMUSP00000154750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067190
AA Change: K738E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: K738E

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164529
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171588
AA Change: K738E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: K738E

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000226471
AA Change: K738E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000226934
Predicted Effect probably benign
Transcript: ENSMUST00000227727
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,245,103 N52I probably damaging Het
Abca5 T C 11: 110,326,631 D133G probably damaging Het
Abcg4 G T 9: 44,279,319 H55Q probably damaging Het
Acaca T A 11: 84,251,290 V641E probably benign Het
Adam28 T C 14: 68,638,103 I229V probably damaging Het
Adgrl3 T A 5: 81,689,646 I793N probably damaging Het
Akr1d1 A T 6: 37,558,401 D240V possibly damaging Het
Arhgef25 T C 10: 127,182,933 D548G probably benign Het
Asl A G 5: 130,013,961 probably null Het
Atg14 C T 14: 47,551,314 R194Q probably damaging Het
BC004004 T A 17: 29,282,192 F38L probably damaging Het
Btg1 T C 10: 96,617,397 F25L probably benign Het
Btrc C T 19: 45,456,587 P35S probably benign Het
Calcr T A 6: 3,714,705 N142Y probably damaging Het
Ccdc138 A G 10: 58,561,996 I553V probably benign Het
Cdc42 T A 4: 137,328,804 N132I probably benign Het
Ces1e A G 8: 93,224,088 S22P probably benign Het
Clmn G T 12: 104,782,048 D413E probably benign Het
Cramp1l T C 17: 24,982,319 T730A probably benign Het
Dnah5 A T 15: 28,343,638 M2395L probably benign Het
Ephx1 G T 1: 181,001,923 S20Y possibly damaging Het
Exoc5 T G 14: 49,052,364 E19A probably damaging Het
Fam120b T C 17: 15,403,032 L424P probably benign Het
Fam89a G A 8: 124,741,084 T163I possibly damaging Het
Fcrls G A 3: 87,259,615 L24F possibly damaging Het
Fgd6 G T 10: 94,139,853 V1377L probably benign Het
Glud1 T A 14: 34,335,390 I337K possibly damaging Het
Gm6370 T A 5: 146,493,926 I303N probably benign Het
Gm7995 T C 14: 42,311,426 Y88H probably damaging Het
Gsdma3 T C 11: 98,629,567 probably null Het
Gsdmc2 T C 15: 63,835,765 D60G probably damaging Het
Hcn1 T A 13: 117,902,895 probably null Het
Hectd1 A T 12: 51,784,247 C936* probably null Het
Herc4 T A 10: 63,285,654 S358T probably benign Het
Hk3 A G 13: 55,010,922 C515R probably benign Het
Ighg1 A G 12: 113,327,518 probably benign Het
Iqgap3 T A 3: 88,107,535 C853S probably benign Het
Irx4 G A 13: 73,267,631 A180T probably damaging Het
Kif20b A G 19: 34,966,122 T1441A probably benign Het
Lmntd2 A T 7: 141,212,618 S218T probably damaging Het
Lnx1 A T 5: 74,607,869 W353R probably benign Het
Lrfn3 G T 7: 30,355,813 P569Q possibly damaging Het
Mamstr A G 7: 45,644,414 I11V probably benign Het
Med31 T C 11: 72,214,149 N32S possibly damaging Het
Mob3c A T 4: 115,833,731 I173F probably benign Het
Morc3 A G 16: 93,870,362 probably null Het
Mphosph9 T C 5: 124,299,045 K412R probably damaging Het
Mthfd1l C T 10: 4,007,775 P271S probably benign Het
Ncam1 C T 9: 49,541,883 probably null Het
Ncbp3 T A 11: 73,069,752 Y279N probably damaging Het
Ncoa6 G A 2: 155,406,767 T1539I probably benign Het
Nedd4 G A 9: 72,740,233 probably null Het
Neil1 A G 9: 57,146,922 V38A probably damaging Het
Ngf T A 3: 102,520,645 F237I probably damaging Het
Nol3 A G 8: 105,279,256 Q94R possibly damaging Het
Obox1 A G 7: 15,556,338 N202S probably damaging Het
Odc1 T A 12: 17,547,385 N29K possibly damaging Het
Olfr1241 C T 2: 89,482,308 V276I probably benign Het
Olfr132 T C 17: 38,130,617 T192A probably damaging Het
Olfr1535 C T 13: 21,555,488 R178H probably benign Het
Olfr243 A C 7: 103,716,707 I38L probably benign Het
P2rx7 T A 5: 122,681,066 V517E probably damaging Het
Parm1 A G 5: 91,593,916 T48A possibly damaging Het
Pcdh9 T A 14: 93,888,728 D2V possibly damaging Het
Pgm3 G T 9: 86,569,325 T92N probably damaging Het
Plcg2 G T 8: 117,607,133 G882* probably null Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Ptprk A T 10: 28,588,932 Y1244F probably damaging Het
Rere G A 4: 150,616,053 A1162T probably damaging Het
Rfx2 T C 17: 56,783,747 E391G probably damaging Het
Sema4c A G 1: 36,552,016 V414A probably damaging Het
Serpinb10 A T 1: 107,540,951 N185I probably damaging Het
Shroom3 T G 5: 92,951,134 M1410R probably benign Het
Slc13a1 A T 6: 24,134,357 S176T probably benign Het
Sntb1 A T 15: 55,642,802 Y458* probably null Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Sorcs1 C T 19: 50,232,303 V570I probably benign Het
Sp8 T A 12: 118,849,070 V220E probably damaging Het
Spry1 C T 3: 37,642,719 T37M possibly damaging Het
Sspo A T 6: 48,460,822 H1305L probably benign Het
Tbc1d22a A G 15: 86,496,916 D509G possibly damaging Het
Tmem108 A T 9: 103,499,077 V391D possibly damaging Het
Tmem132d T A 5: 128,269,300 I53F probably damaging Het
Tmem132d T A 5: 128,269,302 H52L possibly damaging Het
Tnnt2 A T 1: 135,847,758 R87* probably null Het
Ube3a A T 7: 59,243,450 M1L probably benign Het
Unc79 A G 12: 103,094,333 T1119A probably damaging Het
Usf3 A T 16: 44,219,579 H1474L probably damaging Het
Vcpip1 G A 1: 9,747,198 T320I probably damaging Het
Vmn1r56 A G 7: 5,196,444 L58P probably damaging Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Zbtb40 T A 4: 137,000,930 R459W probably benign Het
Zfc3h1 T A 10: 115,410,642 L878Q probably damaging Het
Zfp286 T C 11: 62,780,629 D206G probably benign Het
Zfp46 T A 4: 136,290,481 C209S probably damaging Het
Zufsp G T 10: 33,949,042 T148K probably damaging Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7185739 splice site probably null
IGL01470:Lifr APN 15 7175666 nonsense probably null
IGL01489:Lifr APN 15 7175556 splice site probably benign
IGL01619:Lifr APN 15 7191162 missense probably damaging 1.00
IGL01636:Lifr APN 15 7179018 splice site probably benign
IGL01943:Lifr APN 15 7188149 missense probably damaging 1.00
IGL02253:Lifr APN 15 7190604 missense probably damaging 1.00
IGL02355:Lifr APN 15 7164693 critical splice donor site probably null
IGL02362:Lifr APN 15 7164693 critical splice donor site probably null
IGL02450:Lifr APN 15 7190765 missense probably damaging 1.00
IGL02477:Lifr APN 15 7186923 missense probably damaging 1.00
IGL02503:Lifr APN 15 7185623 missense probably damaging 1.00
IGL02571:Lifr APN 15 7190111 unclassified probably benign
IGL03340:Lifr APN 15 7177936 missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7186953 missense possibly damaging 0.80
R0012:Lifr UTSW 15 7175608 missense possibly damaging 0.78
R0015:Lifr UTSW 15 7188186 unclassified probably null
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0305:Lifr UTSW 15 7177501 missense probably damaging 0.99
R0416:Lifr UTSW 15 7166914 missense probably damaging 1.00
R0440:Lifr UTSW 15 7157191 nonsense probably null
R0519:Lifr UTSW 15 7177580 missense probably damaging 1.00
R0595:Lifr UTSW 15 7177469 missense probably damaging 1.00
R0601:Lifr UTSW 15 7169272 splice site probably null
R0780:Lifr UTSW 15 7177466 missense probably benign 0.00
R0790:Lifr UTSW 15 7185715 missense probably benign 0.13
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1400:Lifr UTSW 15 7190865 missense probably benign 0.04
R1498:Lifr UTSW 15 7190618 missense probably damaging 0.99
R1785:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1786:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1906:Lifr UTSW 15 7188131 missense probably damaging 0.98
R2099:Lifr UTSW 15 7157251 missense probably benign
R2102:Lifr UTSW 15 7186923 missense probably damaging 1.00
R2136:Lifr UTSW 15 7181857 missense possibly damaging 0.89
R2511:Lifr UTSW 15 7166916 missense probably benign
R4375:Lifr UTSW 15 7166898 missense probably benign
R5681:Lifr UTSW 15 7191084 missense probably damaging 1.00
R5689:Lifr UTSW 15 7184804 missense probably damaging 1.00
R5693:Lifr UTSW 15 7175560 missense probably damaging 1.00
R5902:Lifr UTSW 15 7190750 missense probably benign
R5918:Lifr UTSW 15 7159416 missense probably benign 0.00
R5924:Lifr UTSW 15 7172972 missense probably benign 0.28
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6289:Lifr UTSW 15 7166910 missense probably benign 0.00
R6339:Lifr UTSW 15 7167049 missense probably benign 0.01
R6860:Lifr UTSW 15 7172937 missense probably benign 0.02
R7106:Lifr UTSW 15 7172924 missense not run
R7107:Lifr UTSW 15 7178940 missense not run
Predicted Primers PCR Primer
(F):5'- CCGCCTGGTTATTAGCGTAGAG -3'
(R):5'- CTGCTCTTATGTGGCCAGTG -3'

Sequencing Primer
(F):5'- GCGTAGAGTTGTTCAATCATCAGAG -3'
(R):5'- CCAGTGGAAGTCTGTCTGTC -3'
Posted On2016-03-17