Incidental Mutation 'R0305:Lifr'
ID24926
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Nameleukemia inhibitory factor receptor
SynonymsA230075M04Rik, soluble differentiation-stimulating factor receptor
MMRRC Submission 038516-MU
Accession Numbers

Genbank: NM_013584; MGI: 96788  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location7090614-7197489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7177501 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 498 (T498A)
Ref Sequence ENSEMBL: ENSMUSP00000154181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
Predicted Effect probably damaging
Transcript: ENSMUST00000067190
AA Change: T498A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: T498A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164529
AA Change: T498A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263
AA Change: T498A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171588
AA Change: T498A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: T498A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226471
AA Change: T498A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000226934
AA Change: T498A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000227727
AA Change: T498A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7185739 splice site probably null
IGL01470:Lifr APN 15 7175666 nonsense probably null
IGL01489:Lifr APN 15 7175556 splice site probably benign
IGL01619:Lifr APN 15 7191162 missense probably damaging 1.00
IGL01636:Lifr APN 15 7179018 splice site probably benign
IGL01943:Lifr APN 15 7188149 missense probably damaging 1.00
IGL02253:Lifr APN 15 7190604 missense probably damaging 1.00
IGL02355:Lifr APN 15 7164693 critical splice donor site probably null
IGL02362:Lifr APN 15 7164693 critical splice donor site probably null
IGL02450:Lifr APN 15 7190765 missense probably damaging 1.00
IGL02477:Lifr APN 15 7186923 missense probably damaging 1.00
IGL02503:Lifr APN 15 7185623 missense probably damaging 1.00
IGL02571:Lifr APN 15 7190111 unclassified probably benign
IGL03340:Lifr APN 15 7177936 missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7186953 missense possibly damaging 0.80
R0012:Lifr UTSW 15 7175608 missense possibly damaging 0.78
R0015:Lifr UTSW 15 7188186 unclassified probably null
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0416:Lifr UTSW 15 7166914 missense probably damaging 1.00
R0440:Lifr UTSW 15 7157191 nonsense probably null
R0519:Lifr UTSW 15 7177580 missense probably damaging 1.00
R0595:Lifr UTSW 15 7177469 missense probably damaging 1.00
R0601:Lifr UTSW 15 7169272 splice site probably null
R0780:Lifr UTSW 15 7177466 missense probably benign 0.00
R0790:Lifr UTSW 15 7185715 missense probably benign 0.13
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1400:Lifr UTSW 15 7190865 missense probably benign 0.04
R1498:Lifr UTSW 15 7190618 missense probably damaging 0.99
R1785:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1786:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1906:Lifr UTSW 15 7188131 missense probably damaging 0.98
R2099:Lifr UTSW 15 7157251 missense probably benign
R2102:Lifr UTSW 15 7186923 missense probably damaging 1.00
R2136:Lifr UTSW 15 7181857 missense possibly damaging 0.89
R2511:Lifr UTSW 15 7166916 missense probably benign
R4375:Lifr UTSW 15 7166898 missense probably benign
R4883:Lifr UTSW 15 7185625 missense possibly damaging 0.94
R5681:Lifr UTSW 15 7191084 missense probably damaging 1.00
R5689:Lifr UTSW 15 7184804 missense probably damaging 1.00
R5693:Lifr UTSW 15 7175560 missense probably damaging 1.00
R5902:Lifr UTSW 15 7190750 missense probably benign
R5918:Lifr UTSW 15 7159416 missense probably benign 0.00
R5924:Lifr UTSW 15 7172972 missense probably benign 0.28
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6289:Lifr UTSW 15 7166910 missense probably benign 0.00
R6339:Lifr UTSW 15 7167049 missense probably benign 0.01
R6860:Lifr UTSW 15 7172937 missense probably benign 0.02
R7106:Lifr UTSW 15 7172924 missense probably benign 0.02
R7107:Lifr UTSW 15 7178940 missense possibly damaging 0.88
R7274:Lifr UTSW 15 7167059 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAATCGCAAACTAGTATGACATCCA -3'
(R):5'- GTAAGAGAGATGACCCTCAAGGCCA -3'

Sequencing Primer
(F):5'- CGCAAACTAGTATGACATCCATTTGG -3'
(R):5'- TCAAGGCCATGCAAGTGTTC -3'
Posted On2013-04-16