Incidental Mutation 'R6037:Lifr'
ID 486650
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Name LIF receptor alpha
Synonyms soluble differentiation-stimulating factor receptor, A230075M04Rik
MMRRC Submission 043258-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6037 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 7120095-7226970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7216424 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 800 (T800A)
Ref Sequence ENSEMBL: ENSMUSP00000154750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
AlphaFold P42703
Predicted Effect probably damaging
Transcript: ENSMUST00000067190
AA Change: T800A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: T800A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164529
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171588
AA Change: T800A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: T800A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226471
AA Change: T800A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226934
Predicted Effect probably benign
Transcript: ENSMUST00000227727
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Abi2 C A 1: 60,503,738 (GRCm39) P212T probably damaging Het
Ano4 A G 10: 89,153,108 (GRCm39) F68S possibly damaging Het
Art5 C A 7: 101,747,591 (GRCm39) A63S probably benign Het
Asgr1 T A 11: 69,947,247 (GRCm39) S96R probably benign Het
Bdp1 A T 13: 100,163,957 (GRCm39) V2248D possibly damaging Het
Cacna1s C T 1: 135,998,705 (GRCm39) A200V possibly damaging Het
Cacna2d2 A G 9: 107,390,738 (GRCm39) K357E probably damaging Het
Cdhr18 T C 14: 13,864,282 (GRCm38) N348S probably damaging Het
Cfap52 C T 11: 67,837,126 (GRCm39) G212R probably benign Het
Dcun1d3 A G 7: 119,456,965 (GRCm39) F249S probably damaging Het
Ece2 A G 16: 20,449,112 (GRCm39) Y17C probably damaging Het
Efemp1 C T 11: 28,871,760 (GRCm39) T425I probably damaging Het
Eprs1 A G 1: 185,128,306 (GRCm39) E562G probably damaging Het
Fbn2 T C 18: 58,177,295 (GRCm39) T2001A probably benign Het
Flt4 G A 11: 49,527,867 (GRCm39) R940H probably damaging Het
Fry T A 5: 150,351,644 (GRCm39) M1716K probably benign Het
Gm10684 T A 9: 45,019,039 (GRCm39) probably benign Het
Hivep1 G A 13: 42,311,416 (GRCm39) V1219I probably damaging Het
Hyls1 G A 9: 35,472,480 (GRCm39) S312F probably benign Het
Il23r C T 6: 67,455,938 (GRCm39) V177M probably damaging Het
Klf12 T C 14: 100,137,650 (GRCm39) S299G probably benign Het
Lama5 G A 2: 179,848,806 (GRCm39) R265C probably damaging Het
Megf8 T C 7: 25,063,831 (GRCm39) L2729P probably damaging Het
Mki67 A C 7: 135,298,532 (GRCm39) S2167R possibly damaging Het
Mus81 T C 19: 5,534,032 (GRCm39) K400E probably damaging Het
Nomo1 T A 7: 45,712,423 (GRCm39) I656N possibly damaging Het
Oas3 T C 5: 120,907,384 (GRCm39) T418A probably benign Het
Olr1 A G 6: 129,470,504 (GRCm39) L221P probably damaging Het
Or14c44 C T 7: 86,062,478 (GRCm39) L303F probably benign Het
Or5m9 T C 2: 85,876,928 (GRCm39) M34T probably benign Het
Or8b3 T A 9: 38,314,601 (GRCm39) C144S probably benign Het
Or8g22 A G 9: 38,958,403 (GRCm39) V104A probably damaging Het
Or8k28 T A 2: 86,286,133 (GRCm39) I161L probably benign Het
Pih1d1 C T 7: 44,805,738 (GRCm39) A69V probably damaging Het
Pkdrej A C 15: 85,703,967 (GRCm39) S656R probably damaging Het
Polr3f A G 2: 144,377,943 (GRCm39) D171G probably damaging Het
Rasal1 T C 5: 120,787,566 (GRCm39) V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Homo
Sptbn4 T A 7: 27,063,595 (GRCm39) Y2277F probably damaging Het
St6galnac6 A G 2: 32,502,240 (GRCm39) Q7R probably damaging Het
Thrsp T G 7: 97,066,499 (GRCm39) D71A possibly damaging Het
Vmn2r1 C A 3: 63,989,150 (GRCm39) Q30K probably benign Het
Wipf2 C T 11: 98,787,005 (GRCm39) P345S probably benign Het
Zeb2 G T 2: 44,878,652 (GRCm39) S1170* probably null Het
Zfp947 A G 17: 22,366,415 (GRCm39) Y38H probably damaging Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7,215,220 (GRCm39) splice site probably null
IGL01470:Lifr APN 15 7,205,147 (GRCm39) nonsense probably null
IGL01489:Lifr APN 15 7,205,037 (GRCm39) splice site probably benign
IGL01619:Lifr APN 15 7,220,643 (GRCm39) missense probably damaging 1.00
IGL01636:Lifr APN 15 7,208,499 (GRCm39) splice site probably benign
IGL01943:Lifr APN 15 7,217,630 (GRCm39) missense probably damaging 1.00
IGL02253:Lifr APN 15 7,220,085 (GRCm39) missense probably damaging 1.00
IGL02355:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02362:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02450:Lifr APN 15 7,220,246 (GRCm39) missense probably damaging 1.00
IGL02477:Lifr APN 15 7,216,404 (GRCm39) missense probably damaging 1.00
IGL02503:Lifr APN 15 7,215,104 (GRCm39) missense probably damaging 1.00
IGL02571:Lifr APN 15 7,219,592 (GRCm39) unclassified probably benign
IGL03340:Lifr APN 15 7,207,417 (GRCm39) missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7,216,434 (GRCm39) missense possibly damaging 0.80
R0012:Lifr UTSW 15 7,205,089 (GRCm39) missense possibly damaging 0.78
R0015:Lifr UTSW 15 7,217,667 (GRCm39) splice site probably null
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0305:Lifr UTSW 15 7,206,982 (GRCm39) missense probably damaging 0.99
R0416:Lifr UTSW 15 7,196,395 (GRCm39) missense probably damaging 1.00
R0440:Lifr UTSW 15 7,186,672 (GRCm39) nonsense probably null
R0519:Lifr UTSW 15 7,207,061 (GRCm39) missense probably damaging 1.00
R0595:Lifr UTSW 15 7,206,950 (GRCm39) missense probably damaging 1.00
R0601:Lifr UTSW 15 7,198,753 (GRCm39) splice site probably null
R0780:Lifr UTSW 15 7,206,947 (GRCm39) missense probably benign 0.00
R0790:Lifr UTSW 15 7,215,196 (GRCm39) missense probably benign 0.13
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1400:Lifr UTSW 15 7,220,346 (GRCm39) missense probably benign 0.04
R1498:Lifr UTSW 15 7,220,099 (GRCm39) missense probably damaging 0.99
R1785:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1786:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1906:Lifr UTSW 15 7,217,612 (GRCm39) missense probably damaging 0.98
R2099:Lifr UTSW 15 7,186,732 (GRCm39) missense probably benign
R2102:Lifr UTSW 15 7,216,404 (GRCm39) missense probably damaging 1.00
R2136:Lifr UTSW 15 7,211,338 (GRCm39) missense possibly damaging 0.89
R2511:Lifr UTSW 15 7,196,397 (GRCm39) missense probably benign
R4375:Lifr UTSW 15 7,196,379 (GRCm39) missense probably benign
R4883:Lifr UTSW 15 7,215,106 (GRCm39) missense possibly damaging 0.94
R5681:Lifr UTSW 15 7,220,565 (GRCm39) missense probably damaging 1.00
R5689:Lifr UTSW 15 7,214,285 (GRCm39) missense probably damaging 1.00
R5693:Lifr UTSW 15 7,205,041 (GRCm39) missense probably damaging 1.00
R5902:Lifr UTSW 15 7,220,231 (GRCm39) missense probably benign
R5918:Lifr UTSW 15 7,188,897 (GRCm39) missense probably benign 0.00
R5924:Lifr UTSW 15 7,202,453 (GRCm39) missense probably benign 0.28
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6289:Lifr UTSW 15 7,196,391 (GRCm39) missense probably benign 0.00
R6339:Lifr UTSW 15 7,196,530 (GRCm39) missense probably benign 0.01
R6860:Lifr UTSW 15 7,202,418 (GRCm39) missense probably benign 0.02
R7106:Lifr UTSW 15 7,202,405 (GRCm39) missense probably benign 0.02
R7107:Lifr UTSW 15 7,208,421 (GRCm39) missense possibly damaging 0.88
R7274:Lifr UTSW 15 7,196,540 (GRCm39) critical splice donor site probably null
R7625:Lifr UTSW 15 7,198,723 (GRCm39) missense probably damaging 0.99
R7631:Lifr UTSW 15 7,214,258 (GRCm39) missense probably damaging 1.00
R7958:Lifr UTSW 15 7,211,478 (GRCm39) missense possibly damaging 0.62
R7991:Lifr UTSW 15 7,202,963 (GRCm39) missense possibly damaging 0.79
R8175:Lifr UTSW 15 7,216,496 (GRCm39) missense probably damaging 1.00
R8427:Lifr UTSW 15 7,220,462 (GRCm39) missense probably benign 0.01
R9274:Lifr UTSW 15 7,217,591 (GRCm39) missense probably damaging 0.98
R9311:Lifr UTSW 15 7,208,418 (GRCm39) missense possibly damaging 0.47
R9365:Lifr UTSW 15 7,198,521 (GRCm39) missense probably damaging 1.00
R9509:Lifr UTSW 15 7,188,955 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAACTTGAATGTGGCCCCG -3'
(R):5'- CTTACAACAGTGGTCCGCAAC -3'

Sequencing Primer
(F):5'- ATGTGGCCCCGGAGCTTTG -3'
(R):5'- CCTGTATTAAAGGGGTGCATCAC -3'
Posted On 2017-08-16