Incidental Mutation 'R4868:Prx'
ID376327
Institutional Source Beutler Lab
Gene Symbol Prx
Ensembl Gene ENSMUSG00000053198
Gene Nameperiaxin
SynonymsL-Periaxin
MMRRC Submission 042478-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4868 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27499324-27520214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27517579 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 641 (S641P)
Ref Sequence ENSEMBL: ENSMUSP00000066110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108355] [ENSMUST00000125990]
Predicted Effect probably benign
Transcript: ENSMUST00000065487
AA Change: S641P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198
AA Change: S641P

DomainStartEndE-ValueType
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 9.05e-5 PROSPERO
internal_repeat_2 317 428 7.28e-6 PROSPERO
internal_repeat_1 321 508 8.09e-9 PROSPERO
internal_repeat_1 503 779 8.09e-9 PROSPERO
internal_repeat_2 840 974 7.28e-6 PROSPERO
internal_repeat_3 1176 1268 9.05e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098644
AA Change: S641P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198
AA Change: S641P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 5.13e-5 PROSPERO
internal_repeat_2 317 428 3.79e-6 PROSPERO
internal_repeat_1 321 508 3.34e-9 PROSPERO
internal_repeat_1 503 779 3.34e-9 PROSPERO
internal_repeat_2 840 974 3.79e-6 PROSPERO
internal_repeat_3 1176 1268 5.13e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108355
SMART Domains Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125990
AA Change: S502P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display locomotor problems as well as difficulty eating and breathing. Demyelination of peripheral nerves develops with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,710,097 *299W probably null Het
4933412E24Rik G A 15: 60,015,968 L208F possibly damaging Het
Abca8b G A 11: 109,974,512 A373V probably benign Het
Actn3 A T 19: 4,864,454 W549R probably benign Het
Adamts4 C T 1: 171,252,431 probably benign Het
Adcy4 T C 14: 55,773,722 I615V probably benign Het
Akap1 A G 11: 88,844,553 S428P possibly damaging Het
Akap13 A T 7: 75,743,504 R2476W probably damaging Het
Alx3 A G 3: 107,600,627 S151G possibly damaging Het
Aoah T A 13: 20,914,981 Y243* probably null Het
Asap1 A G 15: 64,094,181 V1025A probably benign Het
Atp8b1 A T 18: 64,551,866 I728N probably damaging Het
Baz2b C A 2: 59,924,882 V1001L possibly damaging Het
Bmpr2 T A 1: 59,870,456 S1030T probably benign Het
Cacna2d3 A T 14: 28,956,786 probably null Het
Casp3 A T 8: 46,634,279 N87I probably benign Het
Ccdc171 T A 4: 83,694,332 L995Q probably damaging Het
Ccdc80 T A 16: 45,104,413 Y637N probably damaging Het
Ccr4 A G 9: 114,492,833 F55L probably benign Het
Cmah T A 13: 24,464,264 V494E probably damaging Het
Cnot6l A G 5: 96,083,023 Y362H probably damaging Het
Coq6 T C 12: 84,370,952 V222A probably damaging Het
Ctdspl2 C A 2: 121,993,398 T240N possibly damaging Het
D430041D05Rik T C 2: 104,255,409 T248A possibly damaging Het
Dctn6 A T 8: 34,092,076 probably benign Het
Dhx34 T C 7: 16,199,802 D955G probably benign Het
Dnaaf5 A G 5: 139,170,186 M541V probably benign Het
Dnah17 A T 11: 118,108,212 S912T probably benign Het
Dnah2 A T 11: 69,463,648 V2248E probably damaging Het
Dysf T C 6: 84,179,693 W1502R probably damaging Het
Dzip1 A T 14: 118,877,214 V843E probably damaging Het
Esp23 G T 17: 39,074,024 T27K probably benign Het
Esp3 A T 17: 40,633,529 M21L possibly damaging Het
Fam43b T A 4: 138,395,797 T71S probably benign Het
Fam46b A G 4: 133,486,082 probably null Het
Fpgs G A 2: 32,692,661 R63C probably damaging Het
H2-M11 G T 17: 36,548,919 W268L probably damaging Het
Inpp5b T C 4: 124,751,410 S210P probably damaging Het
Itsn1 T A 16: 91,785,317 S51T probably damaging Het
Kctd2 G A 11: 115,429,379 V246I probably damaging Het
Krt75 C T 15: 101,568,121 G403E probably damaging Het
Lamp3 T A 16: 19,701,290 T48S probably benign Het
Lyzl4 C A 9: 121,583,009 V114L probably damaging Het
Maml3 C A 3: 52,103,924 E74* probably null Het
Map2k7 G A 8: 4,247,751 probably benign Het
Mapk8ip3 A G 17: 24,901,415 V883A probably benign Het
Mbtps1 C T 8: 119,508,928 V1004I probably benign Het
Metap1 G T 3: 138,483,089 H48Q probably damaging Het
Mical2 T A 7: 112,318,624 V396E probably damaging Het
Mks1 T A 11: 87,853,723 probably benign Het
Ndst1 T C 18: 60,695,476 T669A probably benign Het
Obox3 T C 7: 15,627,310 K10R probably damaging Het
Olfr1014 T G 2: 85,776,626 V14G possibly damaging Het
Olfr1318 T A 2: 112,156,571 S207T probably damaging Het
Olfr711 C T 7: 106,971,767 M192I probably benign Het
Opn3 T C 1: 175,663,561 Y302C probably damaging Het
Pdzph1 A T 17: 58,974,756 V177D probably benign Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Pmpcb T A 5: 21,748,853 Y366* probably null Het
Prr14l A T 5: 32,829,937 M738K probably benign Het
Ptchd3 A G 11: 121,831,057 Y252C possibly damaging Het
Reg3a A G 6: 78,381,900 E27G probably damaging Het
Ripor2 A G 13: 24,694,141 T300A possibly damaging Het
Sdf4 T A 4: 156,009,185 S259T probably damaging Het
Sike1 A G 3: 102,997,414 probably null Het
Sis T G 3: 72,943,548 I606L probably benign Het
Slc30a9 T C 5: 67,324,683 I94T probably benign Het
Slc5a4a T C 10: 76,178,231 I424T probably damaging Het
Spx C T 6: 142,416,390 R72* probably null Het
St7 C A 6: 17,819,266 N56K probably damaging Het
Tcte2 C A 17: 13,728,008 G3V probably damaging Het
Tgfb3 T C 12: 86,062,181 D258G probably benign Het
Timeless G T 10: 128,247,361 G659V probably benign Het
Tnn T C 1: 160,130,873 R467G possibly damaging Het
Tor1b T C 2: 30,956,577 probably null Het
Trank1 T A 9: 111,365,641 L911Q probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ttyh3 A T 5: 140,629,466 I389N probably damaging Het
Ube3b T C 5: 114,398,427 V216A probably benign Het
Vezf1 T A 11: 88,074,694 V254E probably damaging Het
Vmn1r122 T C 7: 21,133,302 E276G probably benign Het
Vmn1r167 T A 7: 23,504,736 N285I probably benign Het
Vmn2r45 T A 7: 8,481,481 I442F probably benign Het
Vwa8 C A 14: 79,183,082 A1741E probably damaging Het
Wdr20 T A 12: 110,738,234 V69E probably damaging Het
Xkr4 T G 1: 3,216,851 Q372P probably damaging Het
Zcchc11 T C 4: 108,549,220 probably benign Het
Other mutations in Prx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prx APN 7 27519419 missense probably benign 0.12
IGL01702:Prx APN 7 27519787 missense probably benign 0.00
IGL02012:Prx APN 7 27517901 missense probably damaging 1.00
IGL02214:Prx APN 7 27518912 missense probably damaging 1.00
IGL02498:Prx APN 7 27518072 missense probably damaging 1.00
IGL03029:Prx APN 7 27508061 nonsense probably null
R0522:Prx UTSW 7 27518195 missense probably damaging 0.99
R0655:Prx UTSW 7 27517421 missense probably damaging 1.00
R0904:Prx UTSW 7 27518294 missense probably damaging 1.00
R1161:Prx UTSW 7 27519677 missense probably damaging 1.00
R1170:Prx UTSW 7 27518007 nonsense probably null
R1270:Prx UTSW 7 27518930 missense probably damaging 0.96
R1470:Prx UTSW 7 27517601 missense probably benign 0.19
R1470:Prx UTSW 7 27517601 missense probably benign 0.19
R1536:Prx UTSW 7 27517258 missense probably damaging 0.99
R1721:Prx UTSW 7 27517523 missense probably benign 0.19
R1815:Prx UTSW 7 27516665 missense probably damaging 1.00
R1848:Prx UTSW 7 27518888 missense possibly damaging 0.70
R1894:Prx UTSW 7 27519110 missense possibly damaging 0.68
R2179:Prx UTSW 7 27517985 missense probably benign
R2207:Prx UTSW 7 27516788 missense probably damaging 1.00
R2312:Prx UTSW 7 27516626 missense possibly damaging 0.87
R2356:Prx UTSW 7 27507859 start gained probably benign
R2519:Prx UTSW 7 27518243 missense probably benign 0.43
R2912:Prx UTSW 7 27516229 missense probably damaging 1.00
R4717:Prx UTSW 7 27516727 missense probably benign 0.07
R5153:Prx UTSW 7 27518476 missense probably damaging 1.00
R5418:Prx UTSW 7 27517274 missense probably damaging 0.99
R5653:Prx UTSW 7 27517604 missense probably damaging 1.00
R5895:Prx UTSW 7 27515284 missense probably damaging 1.00
R6022:Prx UTSW 7 27517573 missense probably damaging 1.00
R6112:Prx UTSW 7 27516548 missense probably damaging 1.00
R6223:Prx UTSW 7 27516836 missense probably damaging 1.00
R6560:Prx UTSW 7 27515321 missense probably damaging 1.00
R6888:Prx UTSW 7 27519634 missense possibly damaging 0.73
X0028:Prx UTSW 7 27517733 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTACGACTCCCGGAAGTTC -3'
(R):5'- CATTTCAGGCAGCCGAATGTC -3'

Sequencing Primer
(F):5'- GAAGTTCAGCTGCCCAAAGTGTC -3'
(R):5'- AATGTCCGACACTTTGGGCAG -3'
Posted On2016-03-17