Incidental Mutation 'R4921:Birc6'
ID378649
Institutional Source Beutler Lab
Gene Symbol Birc6
Ensembl Gene ENSMUSG00000024073
Gene Namebaculoviral IAP repeat-containing 6
SynonymsD630005A10Rik, apollon, Bruce, A430032G04Rik, A430040A19Rik
MMRRC Submission 042523-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4921 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location74528295-74703356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74650099 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 3690 (L3690Q)
Ref Sequence ENSEMBL: ENSMUSP00000138693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182597] [ENSMUST00000182817] [ENSMUST00000182944] [ENSMUST00000183224]
Predicted Effect probably damaging
Transcript: ENSMUST00000180037
AA Change: L3696Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073
AA Change: L3696Q

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2253 2266 N/A INTRINSIC
low complexity region 2491 2505 N/A INTRINSIC
low complexity region 2671 2688 N/A INTRINSIC
low complexity region 2893 2905 N/A INTRINSIC
low complexity region 2958 2970 N/A INTRINSIC
Pfam:DUF3643 3477 3632 1e-69 PFAM
low complexity region 3747 3772 N/A INTRINSIC
low complexity region 3900 3919 N/A INTRINSIC
low complexity region 3940 3958 N/A INTRINSIC
low complexity region 3963 3972 N/A INTRINSIC
low complexity region 4146 4157 N/A INTRINSIC
low complexity region 4307 4318 N/A INTRINSIC
low complexity region 4433 4444 N/A INTRINSIC
UBCc 4592 4756 1.04e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182133
AA Change: L3690Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073
AA Change: L3690Q

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2055 N/A INTRINSIC
low complexity region 2136 2157 N/A INTRINSIC
low complexity region 2247 2260 N/A INTRINSIC
low complexity region 2485 2499 N/A INTRINSIC
low complexity region 2665 2682 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 2952 2964 N/A INTRINSIC
Pfam:DUF3643 3470 3626 2.1e-71 PFAM
low complexity region 3741 3766 N/A INTRINSIC
low complexity region 3894 3913 N/A INTRINSIC
low complexity region 3934 3952 N/A INTRINSIC
low complexity region 3957 3966 N/A INTRINSIC
low complexity region 4140 4151 N/A INTRINSIC
low complexity region 4301 4312 N/A INTRINSIC
low complexity region 4427 4438 N/A INTRINSIC
UBCc 4586 4750 1.04e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182597
AA Change: L3705Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073
AA Change: L3705Q

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2262 2275 N/A INTRINSIC
low complexity region 2500 2514 N/A INTRINSIC
low complexity region 2680 2697 N/A INTRINSIC
low complexity region 2902 2914 N/A INTRINSIC
low complexity region 2967 2979 N/A INTRINSIC
Pfam:DUF3643 3485 3641 2.2e-71 PFAM
low complexity region 3756 3781 N/A INTRINSIC
low complexity region 3909 3928 N/A INTRINSIC
low complexity region 3949 3967 N/A INTRINSIC
low complexity region 3972 3981 N/A INTRINSIC
low complexity region 4155 4166 N/A INTRINSIC
low complexity region 4316 4327 N/A INTRINSIC
low complexity region 4442 4453 N/A INTRINSIC
UBCc 4601 4765 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182817
SMART Domains Protein: ENSMUSP00000138349
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 63 82 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182944
AA Change: L3692Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073
AA Change: L3692Q

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1616 1671 N/A INTRINSIC
low complexity region 1705 1722 N/A INTRINSIC
low complexity region 1989 1994 N/A INTRINSIC
low complexity region 2040 2055 N/A INTRINSIC
low complexity region 2138 2159 N/A INTRINSIC
low complexity region 2249 2262 N/A INTRINSIC
low complexity region 2487 2501 N/A INTRINSIC
low complexity region 2667 2684 N/A INTRINSIC
low complexity region 2889 2901 N/A INTRINSIC
low complexity region 2954 2966 N/A INTRINSIC
Pfam:DUF3643 3472 3628 3.2e-71 PFAM
low complexity region 3743 3768 N/A INTRINSIC
low complexity region 3896 3915 N/A INTRINSIC
low complexity region 3936 3954 N/A INTRINSIC
low complexity region 3959 3968 N/A INTRINSIC
low complexity region 4142 4153 N/A INTRINSIC
low complexity region 4303 4314 N/A INTRINSIC
low complexity region 4429 4440 N/A INTRINSIC
UBCc 4588 4752 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183010
Predicted Effect probably damaging
Transcript: ENSMUST00000183224
AA Change: L3676Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073
AA Change: L3676Q

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
BIR 259 335 2.87e-24 SMART
low complexity region 444 465 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
coiled coil region 1606 1661 N/A INTRINSIC
low complexity region 1695 1712 N/A INTRINSIC
low complexity region 1979 1984 N/A INTRINSIC
low complexity region 2030 2041 N/A INTRINSIC
low complexity region 2122 2143 N/A INTRINSIC
low complexity region 2233 2246 N/A INTRINSIC
low complexity region 2471 2485 N/A INTRINSIC
low complexity region 2651 2668 N/A INTRINSIC
low complexity region 2873 2885 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Pfam:DUF3643 3456 3612 3.2e-71 PFAM
low complexity region 3727 3752 N/A INTRINSIC
low complexity region 3880 3899 N/A INTRINSIC
low complexity region 3920 3938 N/A INTRINSIC
low complexity region 3943 3952 N/A INTRINSIC
low complexity region 4126 4137 N/A INTRINSIC
low complexity region 4287 4298 N/A INTRINSIC
low complexity region 4413 4424 N/A INTRINSIC
UBCc 4572 4736 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183249
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,796 N65K probably benign Het
Abcc9 T C 6: 142,590,436 Y1524C probably benign Het
Acap1 A G 11: 69,887,193 I102T probably damaging Het
Acvr2a T C 2: 48,893,541 V284A possibly damaging Het
Adam3 T C 8: 24,684,614 M712V probably benign Het
Adck1 T C 12: 88,441,138 V213A probably benign Het
Adgrl3 G T 5: 81,512,110 W242L probably damaging Het
Alk T C 17: 71,904,315 T857A probably benign Het
Alms1 A G 6: 85,628,546 T2393A probably benign Het
Ank3 C T 10: 70,002,109 P240L probably damaging Het
Ankrd35 C A 3: 96,684,824 L809M possibly damaging Het
Bmp3 C A 5: 98,872,061 F114L probably damaging Het
Cage1 G A 13: 38,019,208 H627Y probably benign Het
Cars T C 7: 143,569,475 D468G probably damaging Het
Ccdc148 T C 2: 58,829,802 E487G probably damaging Het
Ccdc80 A T 16: 45,118,167 I746F probably damaging Het
Ccl25 A G 8: 4,353,913 Q119R possibly damaging Het
Cdh24 C T 14: 54,633,215 D178N probably damaging Het
Cdk12 A T 11: 98,222,687 T766S unknown Het
Chst15 T A 7: 132,247,884 T443S probably benign Het
Cnbp T C 6: 87,845,146 D125G possibly damaging Het
Cntn2 A T 1: 132,516,032 V1003E possibly damaging Het
Crct1 A G 3: 93,014,825 probably benign Het
Dand5 C T 8: 84,816,484 C121Y probably damaging Het
Dmkn A T 7: 30,771,233 D382V probably damaging Het
Dnase2b T A 3: 146,593,441 T86S probably damaging Het
Dusp8 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC 7: 142,082,154 probably benign Het
Eef1akmt1 C T 14: 57,550,632 V90M probably damaging Het
Egfl7 G T 2: 26,590,980 W168L probably benign Het
Ep400 A G 5: 110,665,810 C2908R probably damaging Het
Espl1 A G 15: 102,315,241 K1076E probably damaging Het
Exoc4 A G 6: 33,910,517 N747D probably benign Het
Fancm T C 12: 65,077,141 V191A probably benign Het
Fbxo17 A G 7: 28,732,789 D97G probably benign Het
Fer1l6 G T 15: 58,600,311 probably null Het
Flt4 T C 11: 49,627,143 W337R probably damaging Het
Fpr-rs7 T C 17: 20,113,820 H136R possibly damaging Het
Frem3 T A 8: 80,613,136 I686N possibly damaging Het
Galnt9 A G 5: 110,577,449 K84R probably damaging Het
Gfm2 T A 13: 97,175,676 M760K probably damaging Het
Glis3 T C 19: 28,666,104 T13A probably damaging Het
Gm13078 A T 4: 143,728,326 K398M possibly damaging Het
H2-K1 A G 17: 33,997,076 V323A possibly damaging Het
Hbb-bs G A 7: 103,826,720 A130V probably damaging Het
Herc2 T A 7: 56,229,690 H4685Q probably benign Het
Ighv5-9-1 C T 12: 113,736,294 R56H possibly damaging Het
Itgb4 A G 11: 116,006,605 N1548S probably benign Het
Itpr3 T C 17: 27,098,005 Y745H probably damaging Het
Kank3 G T 17: 33,817,200 G14V probably damaging Het
Kif24 G T 4: 41,394,329 S982Y probably damaging Het
Kifc5b C T 17: 26,921,023 R53W probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Lcat G A 8: 105,942,442 P67L possibly damaging Het
Maml2 T C 9: 13,621,175 S562P probably damaging Het
Map3k8 G A 18: 4,349,124 R65W possibly damaging Het
Mbd3 G T 10: 80,395,576 R12S probably damaging Het
Msr1 T C 8: 39,624,251 E106G possibly damaging Het
Myh4 T A 11: 67,254,028 L1256Q probably damaging Het
Mypn G A 10: 63,147,936 T511M possibly damaging Het
Nub1 A T 5: 24,701,469 N331I probably benign Het
Nup107 A G 10: 117,770,511 V440A possibly damaging Het
Ofcc1 A G 13: 40,214,517 F174L probably benign Het
Olfr1497 T C 19: 13,795,465 I49V probably benign Het
Olfr597 A T 7: 103,320,543 N44I probably damaging Het
Olfr975 A C 9: 39,950,225 V182G probably damaging Het
Parp2 C A 14: 50,819,268 L310I probably damaging Het
Pcdh20 A G 14: 88,469,726 V46A probably benign Het
Pcdhgb6 A G 18: 37,743,472 D411G probably damaging Het
Pkd1l2 T C 8: 117,054,885 E807G probably benign Het
Pkd1l2 A T 8: 117,072,549 N267K probably damaging Het
Rell1 C A 5: 63,936,033 M126I probably damaging Het
Robo4 G A 9: 37,402,560 E36K probably benign Het
Rpgrip1l T C 8: 91,261,009 S807G probably benign Het
Rpl10a T C 17: 28,330,852 V169A probably benign Het
Rubcn C T 16: 32,847,294 V166I probably damaging Het
Sall2 T C 14: 52,315,393 E113G possibly damaging Het
Sars2 T C 7: 28,752,438 S423P possibly damaging Het
Scaper A G 9: 55,892,235 I182T probably benign Het
Selp A G 1: 164,141,397 D522G possibly damaging Het
Sema4b T A 7: 80,198,756 I35N possibly damaging Het
Sgce A T 6: 4,694,153 F268I probably damaging Het
Slc14a2 G T 18: 78,192,188 A258E probably damaging Het
Slc17a9 T C 2: 180,735,949 Y213H probably benign Het
Slc22a7 T G 17: 46,436,933 I233L probably benign Het
Slc35f1 A G 10: 53,062,602 Q210R probably damaging Het
Slc6a21 A G 7: 45,288,310 E350G possibly damaging Het
Spata21 A T 4: 141,112,091 D639V probably damaging Het
Svil A G 18: 5,108,631 D1519G probably damaging Het
Tbccd1 T C 16: 22,841,899 T56A probably benign Het
Tigit A T 16: 43,662,017 I118N probably damaging Het
Tlr11 A T 14: 50,362,885 Q776L possibly damaging Het
Tspan12 A C 6: 21,835,449 I9S possibly damaging Het
Unc5c T A 3: 141,788,966 Y347N probably damaging Het
Unk A G 11: 116,054,945 T481A probably benign Het
Vmn1r192 A C 13: 22,187,480 V190G probably damaging Het
Vnn3 A T 10: 23,864,575 M259L probably benign Het
Zan T C 5: 137,408,370 probably benign Het
Zdhhc6 T C 19: 55,313,210 H113R probably damaging Het
Other mutations in Birc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Birc6 APN 17 74573563 splice site probably benign
IGL00542:Birc6 APN 17 74623771 unclassified probably null
IGL00659:Birc6 APN 17 74660653 missense probably damaging 1.00
IGL00710:Birc6 APN 17 74609089 missense probably benign 0.37
IGL00806:Birc6 APN 17 74611529 missense possibly damaging 0.85
IGL00848:Birc6 APN 17 74696393 nonsense probably null
IGL01071:Birc6 APN 17 74566132 missense possibly damaging 0.84
IGL01071:Birc6 APN 17 74631701 missense probably damaging 1.00
IGL01121:Birc6 APN 17 74631038 missense probably benign 0.08
IGL01132:Birc6 APN 17 74603060 missense probably damaging 1.00
IGL01323:Birc6 APN 17 74622925 missense probably damaging 1.00
IGL01444:Birc6 APN 17 74631687 missense probably damaging 1.00
IGL01511:Birc6 APN 17 74627003 nonsense probably null
IGL01576:Birc6 APN 17 74677370 missense possibly damaging 0.80
IGL01578:Birc6 APN 17 74648197 missense probably benign 0.08
IGL01649:Birc6 APN 17 74604546 missense probably benign 0.03
IGL01657:Birc6 APN 17 74660611 missense probably damaging 1.00
IGL01739:Birc6 APN 17 74659221 missense probably benign
IGL01756:Birc6 APN 17 74640208 missense probably benign 0.00
IGL01807:Birc6 APN 17 74631037 missense probably benign
IGL01885:Birc6 APN 17 74604516 missense possibly damaging 0.51
IGL01906:Birc6 APN 17 74638358 missense probably damaging 1.00
IGL01915:Birc6 APN 17 74631720 missense probably benign 0.34
IGL01998:Birc6 APN 17 74579885 missense probably benign 0.06
IGL02084:Birc6 APN 17 74608282 missense probably benign 0.45
IGL02086:Birc6 APN 17 74639827 missense probably damaging 1.00
IGL02161:Birc6 APN 17 74548837 missense probably damaging 0.99
IGL02195:Birc6 APN 17 74697381 splice site probably benign
IGL02283:Birc6 APN 17 74599940 missense probably benign
IGL02476:Birc6 APN 17 74696391 missense possibly damaging 0.81
IGL02493:Birc6 APN 17 74652059 unclassified probably benign
IGL02547:Birc6 APN 17 74579645 missense probably benign 0.21
IGL02678:Birc6 APN 17 74649903 missense probably damaging 1.00
IGL02713:Birc6 APN 17 74579324 missense probably benign
IGL02851:Birc6 APN 17 74609189 missense probably damaging 1.00
IGL02875:Birc6 APN 17 74589718 missense probably damaging 1.00
IGL02985:Birc6 APN 17 74640190 missense probably benign 0.00
IGL03004:Birc6 APN 17 74612185 missense probably benign 0.10
IGL03053:Birc6 APN 17 74565972 missense probably damaging 1.00
IGL03085:Birc6 APN 17 74596950 missense probably damaging 0.97
IGL03109:Birc6 APN 17 74579334 missense possibly damaging 0.71
IGL03143:Birc6 APN 17 74598999 missense possibly damaging 0.89
IGL03180:Birc6 APN 17 74659231 missense probably benign
IGL03221:Birc6 APN 17 74627007 missense probably benign 0.00
IGL03230:Birc6 APN 17 74611070 missense probably damaging 1.00
IGL03294:Birc6 APN 17 74649886 missense probably benign 0.02
IGL03399:Birc6 APN 17 74594373 missense probably benign 0.01
Badlands UTSW 17 74603036 missense probably damaging 1.00
Black_hills UTSW 17 74692332 missense probably damaging 1.00
bottomlands UTSW 17 74609659 missense probably damaging 1.00
chai UTSW 17 74670374 missense probably damaging 1.00
Sempervirens UTSW 17 74642504 missense probably damaging 1.00
E0370:Birc6 UTSW 17 74677357 missense probably damaging 1.00
PIT4494001:Birc6 UTSW 17 74626980 missense probably damaging 1.00
R0081:Birc6 UTSW 17 74643441 missense probably benign 0.01
R0086:Birc6 UTSW 17 74593166 missense possibly damaging 0.54
R0089:Birc6 UTSW 17 74638376 missense possibly damaging 0.90
R0116:Birc6 UTSW 17 74623746 splice site probably benign
R0129:Birc6 UTSW 17 74528760 missense probably benign 0.05
R0196:Birc6 UTSW 17 74580287 missense possibly damaging 0.57
R0201:Birc6 UTSW 17 74609327 missense possibly damaging 0.92
R0207:Birc6 UTSW 17 74662832 splice site probably benign
R0295:Birc6 UTSW 17 74613362 intron probably benign
R0386:Birc6 UTSW 17 74599340 missense probably damaging 0.99
R0423:Birc6 UTSW 17 74696297 missense probably damaging 1.00
R0449:Birc6 UTSW 17 74692295 missense probably damaging 1.00
R0453:Birc6 UTSW 17 74649754 missense probably damaging 1.00
R0457:Birc6 UTSW 17 74652028 missense probably benign
R0457:Birc6 UTSW 17 74662625 missense probably damaging 1.00
R0564:Birc6 UTSW 17 74625243 splice site probably benign
R0575:Birc6 UTSW 17 74689237 missense probably damaging 1.00
R0582:Birc6 UTSW 17 74643337 missense probably damaging 1.00
R0624:Birc6 UTSW 17 74580349 missense probably benign 0.20
R0973:Birc6 UTSW 17 74565861 missense probably damaging 0.99
R1061:Birc6 UTSW 17 74689312 missense probably damaging 1.00
R1378:Birc6 UTSW 17 74660455 missense probably damaging 1.00
R1402:Birc6 UTSW 17 74697533 splice site probably benign
R1436:Birc6 UTSW 17 74652705 missense probably damaging 1.00
R1456:Birc6 UTSW 17 74609290 missense probably benign 0.35
R1465:Birc6 UTSW 17 74623858 missense probably benign 0.03
R1465:Birc6 UTSW 17 74623858 missense probably benign 0.03
R1474:Birc6 UTSW 17 74579678 missense probably damaging 0.98
R1479:Birc6 UTSW 17 74634853 missense probably damaging 1.00
R1486:Birc6 UTSW 17 74639820 missense probably damaging 1.00
R1499:Birc6 UTSW 17 74612319 missense probably damaging 1.00
R1515:Birc6 UTSW 17 74528636 nonsense probably null
R1549:Birc6 UTSW 17 74662742 missense probably damaging 1.00
R1559:Birc6 UTSW 17 74692237 missense probably damaging 1.00
R1573:Birc6 UTSW 17 74660690 splice site probably benign
R1615:Birc6 UTSW 17 74609409 intron probably null
R1621:Birc6 UTSW 17 74670250 missense probably benign
R1680:Birc6 UTSW 17 74548746 missense probably benign 0.01
R1743:Birc6 UTSW 17 74579756 missense possibly damaging 0.95
R1774:Birc6 UTSW 17 74640013 missense probably damaging 1.00
R1775:Birc6 UTSW 17 74612286 missense probably damaging 1.00
R1818:Birc6 UTSW 17 74649849 missense probably damaging 1.00
R1836:Birc6 UTSW 17 74614390 missense probably benign 0.41
R1931:Birc6 UTSW 17 74565982 missense probably damaging 0.99
R1939:Birc6 UTSW 17 74670337 missense probably damaging 1.00
R1964:Birc6 UTSW 17 74634885 missense possibly damaging 0.94
R1994:Birc6 UTSW 17 74598062 missense probably benign 0.01
R2000:Birc6 UTSW 17 74604619 missense possibly damaging 0.46
R2042:Birc6 UTSW 17 74609659 missense probably damaging 1.00
R2090:Birc6 UTSW 17 74662796 missense probably benign
R2130:Birc6 UTSW 17 74659154 splice site probably benign
R2144:Birc6 UTSW 17 74660413 missense possibly damaging 0.71
R2145:Birc6 UTSW 17 74660413 missense possibly damaging 0.71
R2166:Birc6 UTSW 17 74635795 missense probably benign 0.02
R2180:Birc6 UTSW 17 74612151 missense probably benign 0.03
R2271:Birc6 UTSW 17 74602971 missense probably benign 0.06
R2272:Birc6 UTSW 17 74602971 missense probably benign 0.06
R2416:Birc6 UTSW 17 74608219 missense possibly damaging 0.83
R2420:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2421:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2422:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2513:Birc6 UTSW 17 74647729 missense probably damaging 0.97
R2912:Birc6 UTSW 17 74692206 missense probably damaging 1.00
R3024:Birc6 UTSW 17 74608219 missense possibly damaging 0.83
R3771:Birc6 UTSW 17 74618429 splice site probably benign
R3772:Birc6 UTSW 17 74618429 splice site probably benign
R3829:Birc6 UTSW 17 74655178 missense probably damaging 1.00
R3913:Birc6 UTSW 17 74573613 nonsense probably null
R3915:Birc6 UTSW 17 74579608 missense probably benign 0.12
R3921:Birc6 UTSW 17 74627019 missense probably damaging 0.98
R3928:Birc6 UTSW 17 74611175 missense possibly damaging 0.91
R3928:Birc6 UTSW 17 74638409 missense probably damaging 1.00
R4111:Birc6 UTSW 17 74566015 missense probably damaging 1.00
R4155:Birc6 UTSW 17 74596939 missense probably benign 0.00
R4163:Birc6 UTSW 17 74626980 missense probably damaging 1.00
R4226:Birc6 UTSW 17 74619840 critical splice donor site probably null
R4227:Birc6 UTSW 17 74619840 critical splice donor site probably null
R4358:Birc6 UTSW 17 74619668 intron probably null
R4524:Birc6 UTSW 17 74641777 missense probably damaging 1.00
R4605:Birc6 UTSW 17 74639934 missense probably damaging 1.00
R4619:Birc6 UTSW 17 74640150 missense probably benign 0.18
R4620:Birc6 UTSW 17 74640150 missense probably benign 0.18
R4762:Birc6 UTSW 17 74629489 missense probably damaging 1.00
R4814:Birc6 UTSW 17 74649672 missense probably damaging 1.00
R4849:Birc6 UTSW 17 74647388 missense probably damaging 0.99
R4869:Birc6 UTSW 17 74586012 missense probably benign 0.05
R4912:Birc6 UTSW 17 74565905 missense probably damaging 1.00
R4942:Birc6 UTSW 17 74623050 missense probably damaging 1.00
R4954:Birc6 UTSW 17 74612031 missense probably damaging 1.00
R4992:Birc6 UTSW 17 74689256 missense probably benign 0.44
R4994:Birc6 UTSW 17 74594324 intron probably benign
R5018:Birc6 UTSW 17 74640059 missense probably damaging 1.00
R5022:Birc6 UTSW 17 74692332 missense probably damaging 1.00
R5054:Birc6 UTSW 17 74655325 missense probably damaging 1.00
R5068:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5069:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5070:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5196:Birc6 UTSW 17 74606141 splice site probably benign
R5209:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5212:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5216:Birc6 UTSW 17 74613470 missense probably damaging 1.00
R5279:Birc6 UTSW 17 74650047 missense probably damaging 0.98
R5286:Birc6 UTSW 17 74670247 missense probably damaging 1.00
R5399:Birc6 UTSW 17 74604578 missense possibly damaging 0.75
R5482:Birc6 UTSW 17 74641782 missense possibly damaging 0.86
R5482:Birc6 UTSW 17 74662690 missense probably damaging 1.00
R5492:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5504:Birc6 UTSW 17 74655213 missense probably damaging 1.00
R5519:Birc6 UTSW 17 74580178 missense probably benign
R5544:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5608:Birc6 UTSW 17 74613544 missense probably damaging 0.99
R5623:Birc6 UTSW 17 74528656 missense probably damaging 0.99
R5701:Birc6 UTSW 17 74697425 missense possibly damaging 0.59
R5707:Birc6 UTSW 17 74696404 missense probably damaging 1.00
R5715:Birc6 UTSW 17 74631620 missense probably damaging 1.00
R5734:Birc6 UTSW 17 74618424 splice site probably benign
R5792:Birc6 UTSW 17 74631053 missense probably benign 0.05
R5809:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5810:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5813:Birc6 UTSW 17 74646502 missense probably damaging 1.00
R5933:Birc6 UTSW 17 74599237 missense probably damaging 1.00
R5933:Birc6 UTSW 17 74599238 missense probably damaging 0.98
R5960:Birc6 UTSW 17 74528765 missense probably damaging 0.97
R5961:Birc6 UTSW 17 74646601 missense probably damaging 1.00
R5967:Birc6 UTSW 17 74660439 missense probably damaging 0.99
R5970:Birc6 UTSW 17 74618502 missense possibly damaging 0.95
R5977:Birc6 UTSW 17 74603036 missense probably damaging 1.00
R5982:Birc6 UTSW 17 74648158 missense probably benign
R6023:Birc6 UTSW 17 74654377 missense probably benign 0.24
R6034:Birc6 UTSW 17 74615283 missense probably damaging 1.00
R6034:Birc6 UTSW 17 74615283 missense probably damaging 1.00
R6243:Birc6 UTSW 17 74609387 missense probably damaging 0.96
R6294:Birc6 UTSW 17 74689257 missense probably benign 0.00
R6327:Birc6 UTSW 17 74662779 missense probably damaging 1.00
R6501:Birc6 UTSW 17 74579281 missense probably damaging 1.00
R6810:Birc6 UTSW 17 74612220 missense possibly damaging 0.63
R6822:Birc6 UTSW 17 74580382 missense possibly damaging 0.82
R6822:Birc6 UTSW 17 74598044 missense probably damaging 1.00
R6835:Birc6 UTSW 17 74642504 missense probably damaging 1.00
R6945:Birc6 UTSW 17 74579531 missense probably benign 0.04
R6957:Birc6 UTSW 17 74579491 missense probably benign
R6989:Birc6 UTSW 17 74630989 missense probably benign 0.18
R6991:Birc6 UTSW 17 74562095 missense probably damaging 1.00
R7019:Birc6 UTSW 17 74609345 missense probably benign 0.01
R7092:Birc6 UTSW 17 74646745 missense probably damaging 1.00
R7158:Birc6 UTSW 17 74594376 missense probably benign 0.25
R7204:Birc6 UTSW 17 74640108 missense probably damaging 1.00
R7267:Birc6 UTSW 17 74585985 missense probably benign 0.00
R7316:Birc6 UTSW 17 74604494 missense probably damaging 0.99
R7341:Birc6 UTSW 17 74612074 missense probably damaging 1.00
R7404:Birc6 UTSW 17 74639794 missense possibly damaging 0.73
R7449:Birc6 UTSW 17 74702341 missense probably benign
R7498:Birc6 UTSW 17 74660470 missense probably damaging 1.00
R7539:Birc6 UTSW 17 74649696 missense probably damaging 1.00
R7569:Birc6 UTSW 17 74598082 missense possibly damaging 0.71
R7653:Birc6 UTSW 17 74647734 missense possibly damaging 0.91
Z1088:Birc6 UTSW 17 74611542 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAATCCCACTTGGCAACTC -3'
(R):5'- AAGCTGACCTTGTGCTGCTC -3'

Sequencing Primer
(F):5'- GCTATCAAACAGTTGCTAGACTCGG -3'
(R):5'- CTGCTGTGCCCCTAAATTATG -3'
Posted On2016-04-15