Incidental Mutation 'R1474:Birc6'
ID163966
Institutional Source Beutler Lab
Gene Symbol Birc6
Ensembl Gene ENSMUSG00000024073
Gene Namebaculoviral IAP repeat-containing 6
SynonymsD630005A10Rik, apollon, Bruce, A430032G04Rik, A430040A19Rik
MMRRC Submission 039527-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1474 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74528295-74703356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74579678 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 667 (V667A)
Ref Sequence ENSEMBL: ENSMUSP00000138732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182597] [ENSMUST00000182944] [ENSMUST00000183224]
Predicted Effect probably damaging
Transcript: ENSMUST00000180037
AA Change: V667A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073
AA Change: V667A

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2253 2266 N/A INTRINSIC
low complexity region 2491 2505 N/A INTRINSIC
low complexity region 2671 2688 N/A INTRINSIC
low complexity region 2893 2905 N/A INTRINSIC
low complexity region 2958 2970 N/A INTRINSIC
Pfam:DUF3643 3477 3632 1e-69 PFAM
low complexity region 3747 3772 N/A INTRINSIC
low complexity region 3900 3919 N/A INTRINSIC
low complexity region 3940 3958 N/A INTRINSIC
low complexity region 3963 3972 N/A INTRINSIC
low complexity region 4146 4157 N/A INTRINSIC
low complexity region 4307 4318 N/A INTRINSIC
low complexity region 4433 4444 N/A INTRINSIC
UBCc 4592 4756 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181387
Predicted Effect probably damaging
Transcript: ENSMUST00000182133
AA Change: V667A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073
AA Change: V667A

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2055 N/A INTRINSIC
low complexity region 2136 2157 N/A INTRINSIC
low complexity region 2247 2260 N/A INTRINSIC
low complexity region 2485 2499 N/A INTRINSIC
low complexity region 2665 2682 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 2952 2964 N/A INTRINSIC
Pfam:DUF3643 3470 3626 2.1e-71 PFAM
low complexity region 3741 3766 N/A INTRINSIC
low complexity region 3894 3913 N/A INTRINSIC
low complexity region 3934 3952 N/A INTRINSIC
low complexity region 3957 3966 N/A INTRINSIC
low complexity region 4140 4151 N/A INTRINSIC
low complexity region 4301 4312 N/A INTRINSIC
low complexity region 4427 4438 N/A INTRINSIC
UBCc 4586 4750 1.04e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182597
AA Change: V667A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073
AA Change: V667A

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2262 2275 N/A INTRINSIC
low complexity region 2500 2514 N/A INTRINSIC
low complexity region 2680 2697 N/A INTRINSIC
low complexity region 2902 2914 N/A INTRINSIC
low complexity region 2967 2979 N/A INTRINSIC
Pfam:DUF3643 3485 3641 2.2e-71 PFAM
low complexity region 3756 3781 N/A INTRINSIC
low complexity region 3909 3928 N/A INTRINSIC
low complexity region 3949 3967 N/A INTRINSIC
low complexity region 3972 3981 N/A INTRINSIC
low complexity region 4155 4166 N/A INTRINSIC
low complexity region 4316 4327 N/A INTRINSIC
low complexity region 4442 4453 N/A INTRINSIC
UBCc 4601 4765 1.04e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182944
AA Change: V667A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073
AA Change: V667A

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1616 1671 N/A INTRINSIC
low complexity region 1705 1722 N/A INTRINSIC
low complexity region 1989 1994 N/A INTRINSIC
low complexity region 2040 2055 N/A INTRINSIC
low complexity region 2138 2159 N/A INTRINSIC
low complexity region 2249 2262 N/A INTRINSIC
low complexity region 2487 2501 N/A INTRINSIC
low complexity region 2667 2684 N/A INTRINSIC
low complexity region 2889 2901 N/A INTRINSIC
low complexity region 2954 2966 N/A INTRINSIC
Pfam:DUF3643 3472 3628 3.2e-71 PFAM
low complexity region 3743 3768 N/A INTRINSIC
low complexity region 3896 3915 N/A INTRINSIC
low complexity region 3936 3954 N/A INTRINSIC
low complexity region 3959 3968 N/A INTRINSIC
low complexity region 4142 4153 N/A INTRINSIC
low complexity region 4303 4314 N/A INTRINSIC
low complexity region 4429 4440 N/A INTRINSIC
UBCc 4588 4752 1.04e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183224
AA Change: V639A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073
AA Change: V639A

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
BIR 259 335 2.87e-24 SMART
low complexity region 444 465 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
coiled coil region 1606 1661 N/A INTRINSIC
low complexity region 1695 1712 N/A INTRINSIC
low complexity region 1979 1984 N/A INTRINSIC
low complexity region 2030 2041 N/A INTRINSIC
low complexity region 2122 2143 N/A INTRINSIC
low complexity region 2233 2246 N/A INTRINSIC
low complexity region 2471 2485 N/A INTRINSIC
low complexity region 2651 2668 N/A INTRINSIC
low complexity region 2873 2885 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Pfam:DUF3643 3456 3612 3.2e-71 PFAM
low complexity region 3727 3752 N/A INTRINSIC
low complexity region 3880 3899 N/A INTRINSIC
low complexity region 3920 3938 N/A INTRINSIC
low complexity region 3943 3952 N/A INTRINSIC
low complexity region 4126 4137 N/A INTRINSIC
low complexity region 4287 4298 N/A INTRINSIC
low complexity region 4413 4424 N/A INTRINSIC
UBCc 4572 4736 1.04e-25 SMART
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik C A 7: 139,976,642 R144L probably benign Het
9030624J02Rik T C 7: 118,760,213 F230S probably damaging Het
Abca8a C A 11: 110,069,809 A628S probably damaging Het
Abca9 T C 11: 110,145,579 N568S probably damaging Het
Ada C T 2: 163,732,894 A108T possibly damaging Het
Adam6a T A 12: 113,544,449 D147E possibly damaging Het
Ampd1 A T 3: 103,098,838 T655S probably damaging Het
Ankk1 A G 9: 49,415,839 F680S probably damaging Het
Asap1 G A 15: 64,120,020 T783I probably benign Het
Astn1 T A 1: 158,502,353 N259K probably damaging Het
Brat1 G A 5: 140,712,627 V185I probably benign Het
Btnl6 T C 17: 34,513,646 Y318C probably damaging Het
Caskin2 G A 11: 115,803,696 P360S probably benign Het
Cd68 T A 11: 69,664,928 probably benign Het
Cdca2 T C 14: 67,714,906 probably benign Het
Cdk6 G A 5: 3,473,217 M212I probably benign Het
Ceacam5 T A 7: 17,747,234 F302Y probably damaging Het
Celsr2 T C 3: 108,393,739 E2746G possibly damaging Het
Clec4a4 G A 6: 123,012,744 V115I probably benign Het
Clip3 C A 7: 30,298,882 A251E possibly damaging Het
Cmah T C 13: 24,439,197 L350P probably damaging Het
Cntnap5a C T 1: 116,442,373 R907* probably null Het
Cntnap5b T C 1: 100,072,089 Y191H probably benign Het
Col4a4 A T 1: 82,480,486 C1122* probably null Het
Coq5 A G 5: 115,295,783 probably benign Het
Cpxcr1 A G X: 116,477,439 K16E possibly damaging Het
Dclk3 T C 9: 111,469,236 I616T probably benign Het
Ddx58 A G 4: 40,208,868 V703A possibly damaging Het
Dhrs3 A T 4: 144,919,487 T122S probably damaging Het
Dnm1 T C 2: 32,320,584 I502V probably benign Het
Dscaml1 G T 9: 45,685,221 G788W probably damaging Het
Dusp10 C T 1: 184,037,448 probably null Het
Ehbp1l1 C A 19: 5,719,084 L730F possibly damaging Het
Eif2ak1 C T 5: 143,871,967 H75Y probably damaging Het
Evi2a T C 11: 79,527,572 T71A probably benign Het
Fam184a A T 10: 53,635,365 S1073T probably damaging Het
Fam227a T C 15: 79,615,381 Y591C probably damaging Het
Fam83a C T 15: 58,009,876 T367M probably benign Het
Fam83g A G 11: 61,702,993 D451G probably damaging Het
Fbn1 A G 2: 125,361,265 F1213L possibly damaging Het
Fcgbp G A 7: 28,091,848 V845I probably benign Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxn1 T A 11: 78,361,107 M433L probably benign Het
Gm6583 T C 5: 112,355,776 T21A probably benign Het
Gm6632 T G 5: 59,054,336 noncoding transcript Het
Gnl3 A T 14: 31,016,461 probably benign Het
Hhipl1 C T 12: 108,311,737 T108I probably damaging Het
Hs2st1 A T 3: 144,435,495 F271I possibly damaging Het
Ido1 T C 8: 24,584,446 S303G probably damaging Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Kcnc2 A G 10: 112,456,400 K49E probably damaging Het
Kif3b T A 2: 153,320,315 V482E probably damaging Het
Ldlrad2 G A 4: 137,572,214 P100S probably benign Het
Lrba G T 3: 86,780,266 probably benign Het
Lsm11 A T 11: 45,933,903 W266R probably benign Het
Mob3a A T 10: 80,687,154 M215K probably benign Het
Mterf1b T G 5: 4,197,163 L268R probably damaging Het
Mvk T C 5: 114,460,096 F365L probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Myo1f G T 17: 33,594,027 K602N possibly damaging Het
Nr2c2ap A T 8: 70,133,115 M108L probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Ogfrl1 A G 1: 23,375,809 F206L probably damaging Het
Ola1 A T 2: 73,156,844 I148N probably damaging Het
Olfr1158 A G 2: 87,990,990 N293S probably damaging Het
Olfr1424 T A 19: 12,059,480 T91S probably benign Het
Olfr310 G T 7: 86,269,062 H242Q probably damaging Het
Olfr583 A G 7: 103,052,081 Y261C probably damaging Het
Olfr791 A T 10: 129,526,955 M243L probably benign Het
Otof A G 5: 30,379,532 probably null Het
Pah G T 10: 87,578,313 K341N probably damaging Het
Pfdn5 T A 15: 102,328,511 probably null Het
Piezo2 A G 18: 63,083,131 C960R probably damaging Het
Pitx2 T C 3: 129,218,839 V306A probably damaging Het
Pkd1l2 C A 8: 117,065,497 probably benign Het
Plekho1 T C 3: 95,989,566 E197G probably damaging Het
Polr2i A G 7: 30,232,802 N34S probably damaging Het
Psph A T 5: 129,771,550 D22E probably damaging Het
Ptprs C A 17: 56,424,128 A687S probably damaging Het
Ralgapa1 T C 12: 55,741,480 K606R probably benign Het
Rims1 A G 1: 22,538,281 probably benign Het
Rnf213 C T 11: 119,437,750 P2002L probably damaging Het
Ryr3 A T 2: 112,909,962 C555S probably damaging Het
Sftpd C A 14: 41,172,427 G345V probably damaging Het
Slc41a1 T A 1: 131,846,581 M462K probably damaging Het
Slc44a2 A G 9: 21,353,694 E676G probably damaging Het
Sox6 T A 7: 115,701,691 probably benign Het
Spdye4b G A 5: 143,195,717 R109Q probably damaging Het
Spink8 A T 9: 109,820,638 I63L probably damaging Het
St3gal3 A G 4: 118,014,786 L73P probably damaging Het
Stab1 A G 14: 31,149,861 L1247P probably benign Het
Tat A G 8: 109,991,563 R27G probably benign Het
Tcerg1l C T 7: 138,280,075 R295H probably damaging Het
Tfrc T C 16: 32,626,649 V596A probably damaging Het
Tgfb3 C T 12: 86,069,346 probably null Het
Tmed5 A T 5: 108,132,382 S15T probably benign Het
Tph1 A T 7: 46,653,862 S231T probably benign Het
Trim30d G A 7: 104,472,494 S198L probably damaging Het
Trpm6 T C 19: 18,796,495 M412T probably benign Het
Ttn G T 2: 76,782,245 D15417E probably benign Het
U2surp A G 9: 95,493,198 I157T possibly damaging Het
Ubr4 A G 4: 139,429,579 D2305G probably damaging Het
Uvssa A G 5: 33,388,821 K179E probably benign Het
Xirp2 A G 2: 67,525,067 K3391E probably benign Het
Xpo7 T A 14: 70,699,033 H170L probably benign Het
Zrsr1 T C 11: 22,974,404 W393R probably benign Het
Other mutations in Birc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Birc6 APN 17 74573563 splice site probably benign
IGL00542:Birc6 APN 17 74623771 unclassified probably null
IGL00659:Birc6 APN 17 74660653 missense probably damaging 1.00
IGL00710:Birc6 APN 17 74609089 missense probably benign 0.37
IGL00806:Birc6 APN 17 74611529 missense possibly damaging 0.85
IGL00848:Birc6 APN 17 74696393 nonsense probably null
IGL01071:Birc6 APN 17 74566132 missense possibly damaging 0.84
IGL01071:Birc6 APN 17 74631701 missense probably damaging 1.00
IGL01121:Birc6 APN 17 74631038 missense probably benign 0.08
IGL01132:Birc6 APN 17 74603060 missense probably damaging 1.00
IGL01323:Birc6 APN 17 74622925 missense probably damaging 1.00
IGL01444:Birc6 APN 17 74631687 missense probably damaging 1.00
IGL01511:Birc6 APN 17 74627003 nonsense probably null
IGL01576:Birc6 APN 17 74677370 missense possibly damaging 0.80
IGL01578:Birc6 APN 17 74648197 missense probably benign 0.08
IGL01649:Birc6 APN 17 74604546 missense probably benign 0.03
IGL01657:Birc6 APN 17 74660611 missense probably damaging 1.00
IGL01739:Birc6 APN 17 74659221 missense probably benign
IGL01756:Birc6 APN 17 74640208 missense probably benign 0.00
IGL01807:Birc6 APN 17 74631037 missense probably benign
IGL01885:Birc6 APN 17 74604516 missense possibly damaging 0.51
IGL01906:Birc6 APN 17 74638358 missense probably damaging 1.00
IGL01915:Birc6 APN 17 74631720 missense probably benign 0.34
IGL01998:Birc6 APN 17 74579885 missense probably benign 0.06
IGL02084:Birc6 APN 17 74608282 missense probably benign 0.45
IGL02086:Birc6 APN 17 74639827 missense probably damaging 1.00
IGL02161:Birc6 APN 17 74548837 missense probably damaging 0.99
IGL02195:Birc6 APN 17 74697381 splice site probably benign
IGL02283:Birc6 APN 17 74599940 missense probably benign
IGL02476:Birc6 APN 17 74696391 missense possibly damaging 0.81
IGL02493:Birc6 APN 17 74652059 unclassified probably benign
IGL02547:Birc6 APN 17 74579645 missense probably benign 0.21
IGL02678:Birc6 APN 17 74649903 missense probably damaging 1.00
IGL02713:Birc6 APN 17 74579324 missense probably benign
IGL02851:Birc6 APN 17 74609189 missense probably damaging 1.00
IGL02875:Birc6 APN 17 74589718 missense probably damaging 1.00
IGL02985:Birc6 APN 17 74640190 missense probably benign 0.00
IGL03004:Birc6 APN 17 74612185 missense probably benign 0.10
IGL03053:Birc6 APN 17 74565972 missense probably damaging 1.00
IGL03085:Birc6 APN 17 74596950 missense probably damaging 0.97
IGL03109:Birc6 APN 17 74579334 missense possibly damaging 0.71
IGL03143:Birc6 APN 17 74598999 missense possibly damaging 0.89
IGL03180:Birc6 APN 17 74659231 missense probably benign
IGL03221:Birc6 APN 17 74627007 missense probably benign 0.00
IGL03230:Birc6 APN 17 74611070 missense probably damaging 1.00
IGL03294:Birc6 APN 17 74649886 missense probably benign 0.02
IGL03399:Birc6 APN 17 74594373 missense probably benign 0.01
Badlands UTSW 17 74603036 missense probably damaging 1.00
Black_hills UTSW 17 74692332 missense probably damaging 1.00
bottomlands UTSW 17 74609659 missense probably damaging 1.00
chai UTSW 17 74670374 missense probably damaging 1.00
Sempervirens UTSW 17 74642504 missense probably damaging 1.00
E0370:Birc6 UTSW 17 74677357 missense probably damaging 1.00
PIT4494001:Birc6 UTSW 17 74626980 missense probably damaging 1.00
R0081:Birc6 UTSW 17 74643441 missense probably benign 0.01
R0086:Birc6 UTSW 17 74593166 missense possibly damaging 0.54
R0089:Birc6 UTSW 17 74638376 missense possibly damaging 0.90
R0116:Birc6 UTSW 17 74623746 splice site probably benign
R0129:Birc6 UTSW 17 74528760 missense probably benign 0.05
R0196:Birc6 UTSW 17 74580287 missense possibly damaging 0.57
R0201:Birc6 UTSW 17 74609327 missense possibly damaging 0.92
R0207:Birc6 UTSW 17 74662832 splice site probably benign
R0295:Birc6 UTSW 17 74613362 intron probably benign
R0386:Birc6 UTSW 17 74599340 missense probably damaging 0.99
R0423:Birc6 UTSW 17 74696297 missense probably damaging 1.00
R0449:Birc6 UTSW 17 74692295 missense probably damaging 1.00
R0453:Birc6 UTSW 17 74649754 missense probably damaging 1.00
R0457:Birc6 UTSW 17 74652028 missense probably benign
R0457:Birc6 UTSW 17 74662625 missense probably damaging 1.00
R0564:Birc6 UTSW 17 74625243 splice site probably benign
R0575:Birc6 UTSW 17 74689237 missense probably damaging 1.00
R0582:Birc6 UTSW 17 74643337 missense probably damaging 1.00
R0624:Birc6 UTSW 17 74580349 missense probably benign 0.20
R0973:Birc6 UTSW 17 74565861 missense probably damaging 0.99
R1061:Birc6 UTSW 17 74689312 missense probably damaging 1.00
R1378:Birc6 UTSW 17 74660455 missense probably damaging 1.00
R1402:Birc6 UTSW 17 74697533 splice site probably benign
R1436:Birc6 UTSW 17 74652705 missense probably damaging 1.00
R1456:Birc6 UTSW 17 74609290 missense probably benign 0.35
R1465:Birc6 UTSW 17 74623858 missense probably benign 0.03
R1465:Birc6 UTSW 17 74623858 missense probably benign 0.03
R1479:Birc6 UTSW 17 74634853 missense probably damaging 1.00
R1486:Birc6 UTSW 17 74639820 missense probably damaging 1.00
R1499:Birc6 UTSW 17 74612319 missense probably damaging 1.00
R1515:Birc6 UTSW 17 74528636 nonsense probably null
R1549:Birc6 UTSW 17 74662742 missense probably damaging 1.00
R1559:Birc6 UTSW 17 74692237 missense probably damaging 1.00
R1573:Birc6 UTSW 17 74660690 splice site probably benign
R1615:Birc6 UTSW 17 74609409 intron probably null
R1621:Birc6 UTSW 17 74670250 missense probably benign
R1680:Birc6 UTSW 17 74548746 missense probably benign 0.01
R1743:Birc6 UTSW 17 74579756 missense possibly damaging 0.95
R1774:Birc6 UTSW 17 74640013 missense probably damaging 1.00
R1775:Birc6 UTSW 17 74612286 missense probably damaging 1.00
R1818:Birc6 UTSW 17 74649849 missense probably damaging 1.00
R1836:Birc6 UTSW 17 74614390 missense probably benign 0.41
R1931:Birc6 UTSW 17 74565982 missense probably damaging 0.99
R1939:Birc6 UTSW 17 74670337 missense probably damaging 1.00
R1964:Birc6 UTSW 17 74634885 missense possibly damaging 0.94
R1994:Birc6 UTSW 17 74598062 missense probably benign 0.01
R2000:Birc6 UTSW 17 74604619 missense possibly damaging 0.46
R2042:Birc6 UTSW 17 74609659 missense probably damaging 1.00
R2090:Birc6 UTSW 17 74662796 missense probably benign
R2130:Birc6 UTSW 17 74659154 splice site probably benign
R2144:Birc6 UTSW 17 74660413 missense possibly damaging 0.71
R2145:Birc6 UTSW 17 74660413 missense possibly damaging 0.71
R2166:Birc6 UTSW 17 74635795 missense probably benign 0.02
R2180:Birc6 UTSW 17 74612151 missense probably benign 0.03
R2271:Birc6 UTSW 17 74602971 missense probably benign 0.06
R2272:Birc6 UTSW 17 74602971 missense probably benign 0.06
R2416:Birc6 UTSW 17 74608219 missense possibly damaging 0.83
R2420:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2421:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2422:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2513:Birc6 UTSW 17 74647729 missense probably damaging 0.97
R2912:Birc6 UTSW 17 74692206 missense probably damaging 1.00
R3024:Birc6 UTSW 17 74608219 missense possibly damaging 0.83
R3771:Birc6 UTSW 17 74618429 splice site probably benign
R3772:Birc6 UTSW 17 74618429 splice site probably benign
R3829:Birc6 UTSW 17 74655178 missense probably damaging 1.00
R3913:Birc6 UTSW 17 74573613 nonsense probably null
R3915:Birc6 UTSW 17 74579608 missense probably benign 0.12
R3921:Birc6 UTSW 17 74627019 missense probably damaging 0.98
R3928:Birc6 UTSW 17 74611175 missense possibly damaging 0.91
R3928:Birc6 UTSW 17 74638409 missense probably damaging 1.00
R4111:Birc6 UTSW 17 74566015 missense probably damaging 1.00
R4155:Birc6 UTSW 17 74596939 missense probably benign 0.00
R4163:Birc6 UTSW 17 74626980 missense probably damaging 1.00
R4226:Birc6 UTSW 17 74619840 critical splice donor site probably null
R4227:Birc6 UTSW 17 74619840 critical splice donor site probably null
R4358:Birc6 UTSW 17 74619668 intron probably null
R4524:Birc6 UTSW 17 74641777 missense probably damaging 1.00
R4605:Birc6 UTSW 17 74639934 missense probably damaging 1.00
R4619:Birc6 UTSW 17 74640150 missense probably benign 0.18
R4620:Birc6 UTSW 17 74640150 missense probably benign 0.18
R4762:Birc6 UTSW 17 74629489 missense probably damaging 1.00
R4814:Birc6 UTSW 17 74649672 missense probably damaging 1.00
R4849:Birc6 UTSW 17 74647388 missense probably damaging 0.99
R4869:Birc6 UTSW 17 74586012 missense probably benign 0.05
R4912:Birc6 UTSW 17 74565905 missense probably damaging 1.00
R4921:Birc6 UTSW 17 74650099 missense probably damaging 1.00
R4942:Birc6 UTSW 17 74623050 missense probably damaging 1.00
R4954:Birc6 UTSW 17 74612031 missense probably damaging 1.00
R4992:Birc6 UTSW 17 74689256 missense probably benign 0.44
R4994:Birc6 UTSW 17 74594324 intron probably benign
R5018:Birc6 UTSW 17 74640059 missense probably damaging 1.00
R5022:Birc6 UTSW 17 74692332 missense probably damaging 1.00
R5054:Birc6 UTSW 17 74655325 missense probably damaging 1.00
R5068:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5069:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5070:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5196:Birc6 UTSW 17 74606141 splice site probably benign
R5209:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5212:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5216:Birc6 UTSW 17 74613470 missense probably damaging 1.00
R5279:Birc6 UTSW 17 74650047 missense probably damaging 0.98
R5286:Birc6 UTSW 17 74670247 missense probably damaging 1.00
R5399:Birc6 UTSW 17 74604578 missense possibly damaging 0.75
R5482:Birc6 UTSW 17 74641782 missense possibly damaging 0.86
R5482:Birc6 UTSW 17 74662690 missense probably damaging 1.00
R5492:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5504:Birc6 UTSW 17 74655213 missense probably damaging 1.00
R5519:Birc6 UTSW 17 74580178 missense probably benign
R5544:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5608:Birc6 UTSW 17 74613544 missense probably damaging 0.99
R5623:Birc6 UTSW 17 74528656 missense probably damaging 0.99
R5701:Birc6 UTSW 17 74697425 missense possibly damaging 0.59
R5707:Birc6 UTSW 17 74696404 missense probably damaging 1.00
R5715:Birc6 UTSW 17 74631620 missense probably damaging 1.00
R5734:Birc6 UTSW 17 74618424 splice site probably benign
R5792:Birc6 UTSW 17 74631053 missense probably benign 0.05
R5809:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5810:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5813:Birc6 UTSW 17 74646502 missense probably damaging 1.00
R5933:Birc6 UTSW 17 74599237 missense probably damaging 1.00
R5933:Birc6 UTSW 17 74599238 missense probably damaging 0.98
R5960:Birc6 UTSW 17 74528765 missense probably damaging 0.97
R5961:Birc6 UTSW 17 74646601 missense probably damaging 1.00
R5967:Birc6 UTSW 17 74660439 missense probably damaging 0.99
R5970:Birc6 UTSW 17 74618502 missense possibly damaging 0.95
R5977:Birc6 UTSW 17 74603036 missense probably damaging 1.00
R5982:Birc6 UTSW 17 74648158 missense probably benign
R6023:Birc6 UTSW 17 74654377 missense probably benign 0.24
R6034:Birc6 UTSW 17 74615283 missense probably damaging 1.00
R6034:Birc6 UTSW 17 74615283 missense probably damaging 1.00
R6243:Birc6 UTSW 17 74609387 missense probably damaging 0.96
R6294:Birc6 UTSW 17 74689257 missense probably benign 0.00
R6327:Birc6 UTSW 17 74662779 missense probably damaging 1.00
R6501:Birc6 UTSW 17 74579281 missense probably damaging 1.00
R6810:Birc6 UTSW 17 74612220 missense possibly damaging 0.63
R6822:Birc6 UTSW 17 74580382 missense possibly damaging 0.82
R6822:Birc6 UTSW 17 74598044 missense probably damaging 1.00
R6835:Birc6 UTSW 17 74642504 missense probably damaging 1.00
R6945:Birc6 UTSW 17 74579531 missense probably benign 0.04
R6957:Birc6 UTSW 17 74579491 missense probably benign
R6989:Birc6 UTSW 17 74630989 missense probably benign 0.18
R6991:Birc6 UTSW 17 74562095 missense probably damaging 1.00
R7019:Birc6 UTSW 17 74609345 missense probably benign 0.01
R7092:Birc6 UTSW 17 74646745 missense probably damaging 1.00
R7158:Birc6 UTSW 17 74594376 missense probably benign 0.25
R7204:Birc6 UTSW 17 74640108 missense probably damaging 1.00
R7267:Birc6 UTSW 17 74585985 missense probably benign 0.00
R7316:Birc6 UTSW 17 74604494 missense probably damaging 0.99
R7341:Birc6 UTSW 17 74612074 missense probably damaging 1.00
R7404:Birc6 UTSW 17 74639794 missense possibly damaging 0.73
R7449:Birc6 UTSW 17 74702341 missense probably benign
R7498:Birc6 UTSW 17 74660470 missense probably damaging 1.00
R7539:Birc6 UTSW 17 74649696 missense probably damaging 1.00
R7569:Birc6 UTSW 17 74598082 missense possibly damaging 0.71
R7653:Birc6 UTSW 17 74647734 missense possibly damaging 0.91
Z1088:Birc6 UTSW 17 74611542 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCTCTCAGCATTCTCCAGCAG -3'
(R):5'- GCAAACTTTGGTAGCCTCAAGCAC -3'

Sequencing Primer
(F):5'- AATTCTCACAGGTCACTGGATGG -3'
(R):5'- GTAGCCTCAAGCACTGCAC -3'
Posted On2014-03-28