Incidental Mutation 'R4936:Rcc1'
ID380358
Institutional Source Beutler Lab
Gene Symbol Rcc1
Ensembl Gene ENSMUSG00000028896
Gene Nameregulator of chromosome condensation 1
SynonymsChc1, 4931417M11Rik
MMRRC Submission 042536-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R4936 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location132331919-132353605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 132335735 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 187 (V187L)
Ref Sequence ENSEMBL: ENSMUSP00000030726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030726] [ENSMUST00000084250] [ENSMUST00000105951] [ENSMUST00000155129]
Predicted Effect probably damaging
Transcript: ENSMUST00000030726
AA Change: V187L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030726
Gene: ENSMUSG00000028896
AA Change: V187L

DomainStartEndE-ValueType
Pfam:RCC1 47 95 7.9e-12 PFAM
Pfam:RCC1 98 147 7.5e-17 PFAM
Pfam:RCC1_2 134 165 1.3e-11 PFAM
Pfam:RCC1 150 200 9.9e-10 PFAM
Pfam:RCC1_2 187 216 3.2e-7 PFAM
Pfam:RCC1 203 268 4.2e-14 PFAM
Pfam:RCC1 271 322 1.1e-11 PFAM
Pfam:RCC1 325 373 3.4e-10 PFAM
Pfam:RCC1 376 427 3.4e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000084250
AA Change: V174L

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081271
Gene: ENSMUSG00000028896
AA Change: V174L

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 4.1e-10 PFAM
Pfam:RCC1 85 134 1.4e-13 PFAM
Pfam:RCC1_2 121 151 1.5e-8 PFAM
Pfam:RCC1 137 187 1.7e-7 PFAM
Pfam:RCC1_2 174 203 3e-5 PFAM
Pfam:RCC1 190 255 9.6e-11 PFAM
Pfam:RCC1 258 309 1.9e-9 PFAM
Pfam:RCC1 312 360 5.7e-9 PFAM
Pfam:RCC1 363 414 3.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105951
AA Change: V174L

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101571
Gene: ENSMUSG00000028896
AA Change: V174L

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 4.1e-10 PFAM
Pfam:RCC1 85 134 1.4e-13 PFAM
Pfam:RCC1_2 121 151 1.5e-8 PFAM
Pfam:RCC1 137 187 1.7e-7 PFAM
Pfam:RCC1_2 174 203 3e-5 PFAM
Pfam:RCC1 190 255 9.6e-11 PFAM
Pfam:RCC1 258 309 1.9e-9 PFAM
Pfam:RCC1 312 360 5.7e-9 PFAM
Pfam:RCC1 363 414 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137238
Predicted Effect probably benign
Transcript: ENSMUST00000155129
SMART Domains Protein: ENSMUSP00000120701
Gene: ENSMUSG00000028896

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 3.9e-13 PFAM
Pfam:RCC1_2 69 98 5.2e-7 PFAM
Pfam:RCC1 85 116 5.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156710
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,315 F183L possibly damaging Het
4930590J08Rik T A 6: 91,944,264 M775K probably damaging Het
Actn1 T G 12: 80,172,998 I700L probably benign Het
Adam5 T C 8: 24,786,271 Y460C probably damaging Het
Akna C T 4: 63,395,265 G207E probably damaging Het
Ank2 T A 3: 126,955,039 H527L possibly damaging Het
Anks1 C A 17: 27,988,805 N383K probably damaging Het
Apba3 C T 10: 81,269,370 probably null Het
Atp9b C A 18: 80,736,093 V1121F possibly damaging Het
Bsn T C 9: 108,111,761 Y2264C probably damaging Het
Bst1 A G 5: 43,840,457 D266G probably damaging Het
Cep55 A G 19: 38,071,754 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckb T C 12: 111,671,230 K156E probably benign Het
Cln3 T A 7: 126,575,221 H315L probably damaging Het
Cnot6l A G 5: 96,079,937 F479S probably damaging Het
Col1a1 A G 11: 94,947,132 D826G unknown Het
Cyp27a1 T C 1: 74,735,405 V194A probably benign Het
Dis3l2 C T 1: 87,044,168 P643S probably benign Het
Dpf3 T C 12: 83,331,966 D108G probably damaging Het
Eif2b4 C T 5: 31,192,897 G27D probably benign Het
Eif4a1 T G 11: 69,672,425 probably benign Het
Espl1 A T 15: 102,304,937 D566V probably damaging Het
Ext2 T A 2: 93,813,679 R86* probably null Het
Fasn A T 11: 120,816,085 F914I probably damaging Het
Fbf1 A G 11: 116,152,552 L477P probably benign Het
Fsd1 A T 17: 55,996,452 K441N possibly damaging Het
Fsip2 T A 2: 82,985,040 S3706T probably benign Het
Gabra5 A T 7: 57,408,799 N400K probably benign Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gli2 A G 1: 118,836,140 V1427A probably benign Het
Gm7334 A T 17: 50,698,827 Y47F probably damaging Het
Gm8674 T G 13: 49,900,755 noncoding transcript Het
Gmeb2 G T 2: 181,254,246 T377K probably benign Het
Gp9 T A 6: 87,779,247 D81E probably benign Het
Il5ra T A 6: 106,738,162 I212F possibly damaging Het
Klhl18 G T 9: 110,428,961 N470K possibly damaging Het
Lfng G T 5: 140,612,395 probably null Het
Lpo A G 11: 87,810,340 I430T probably benign Het
Lrrc31 C T 3: 30,689,268 D183N probably damaging Het
Meis2 T C 2: 115,864,412 T410A probably benign Het
Myo6 A G 9: 80,307,681 D1232G probably damaging Het
Ncapd2 C T 6: 125,169,840 R1261H probably benign Het
Nfkb1 C T 3: 135,613,982 V251M probably damaging Het
Nmbr C A 10: 14,766,986 H96Q probably damaging Het
Nop14 C T 5: 34,652,393 R256H probably damaging Het
Nqo2 T A 13: 33,981,518 Y133N probably damaging Het
Olfr1153 A G 2: 87,896,813 I213V probably benign Het
Olfr1366 T C 13: 21,537,187 I273V probably benign Het
Pbld2 C A 10: 63,052,238 S168R probably damaging Het
Pcdhb7 G T 18: 37,342,149 G113* probably null Het
Pcdhb7 G T 18: 37,342,150 G113V probably damaging Het
Pdgfra A T 5: 75,195,026 T1066S probably damaging Het
Prdm8 A T 5: 98,185,022 probably null Het
Prdm8 G T 5: 98,185,023 probably null Het
Prkg1 T C 19: 30,586,375 Y479C probably benign Het
Pudp T C 18: 50,568,468 T65A probably benign Het
Rbbp6 C T 7: 122,999,703 probably benign Het
Rims2 T A 15: 39,437,728 M285K probably damaging Het
Rtkn2 T C 10: 68,041,915 *602Q probably null Het
Rxfp3 T G 15: 11,036,780 S169R probably damaging Het
Sardh T C 2: 27,228,241 probably null Het
Slc24a2 A T 4: 87,227,347 F157I probably damaging Het
Slc25a20 T C 9: 108,681,992 Y186H probably damaging Het
Slc25a24 A G 3: 109,163,548 R408G probably damaging Het
Slc44a5 T G 3: 154,253,716 I348S probably damaging Het
Slc8a2 A T 7: 16,134,175 K111* probably null Het
Smc5 A G 19: 23,234,003 V589A probably damaging Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
Thsd7b T C 1: 129,678,145 M541T probably benign Het
Tie1 T A 4: 118,484,771 silent Het
Tln1 A G 4: 43,547,522 F813S possibly damaging Het
Tnrc18 A T 5: 142,765,977 L1191* probably null Het
Tubb2a A C 13: 34,075,257 Y183* probably null Het
Ubr4 T A 4: 139,396,566 V343E probably damaging Het
Vmn2r93 A T 17: 18,304,065 D107V possibly damaging Het
Vwa5a T G 9: 38,736,198 S624R probably benign Het
Wwox G A 8: 114,706,358 V255I probably benign Het
Wwp1 T C 4: 19,638,804 K546E probably damaging Het
Xirp2 T A 2: 67,509,819 F801L possibly damaging Het
Zfp407 T C 18: 84,559,464 I1175V probably benign Het
Zfp646 T A 7: 127,881,761 C1037S possibly damaging Het
Zfp786 A T 6: 47,821,268 C245* probably null Het
Zfp827 T C 8: 79,061,183 V326A probably benign Het
Other mutations in Rcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02881:Rcc1 APN 4 132337756 missense probably benign 0.20
IGL02927:Rcc1 APN 4 132337756 missense probably benign 0.20
IGL02802:Rcc1 UTSW 4 132337756 missense probably benign 0.20
IGL02837:Rcc1 UTSW 4 132337756 missense probably benign 0.20
R0240:Rcc1 UTSW 4 132332915 missense probably damaging 1.00
R0240:Rcc1 UTSW 4 132332915 missense probably damaging 1.00
R0828:Rcc1 UTSW 4 132335825 unclassified probably benign
R1606:Rcc1 UTSW 4 132334776 unclassified probably null
R2155:Rcc1 UTSW 4 132338049 critical splice donor site probably null
R3721:Rcc1 UTSW 4 132337814 missense possibly damaging 0.46
R4633:Rcc1 UTSW 4 132335769 missense probably damaging 0.98
R4908:Rcc1 UTSW 4 132337753 missense probably damaging 1.00
R5461:Rcc1 UTSW 4 132334186 missense probably benign 0.00
R5627:Rcc1 UTSW 4 132338143 missense probably damaging 0.98
R6088:Rcc1 UTSW 4 132332842 missense probably benign 0.00
R6197:Rcc1 UTSW 4 132337762 missense possibly damaging 0.58
R6456:Rcc1 UTSW 4 132334116 missense probably benign 0.10
R7127:Rcc1 UTSW 4 132334796 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCGTGAGCATCACCAAGTGG -3'
(R):5'- ATTTCCATGTGTGGCCAGGC -3'

Sequencing Primer
(F):5'- CCAAGTGGTCGTTCCCTGTG -3'
(R):5'- AGGCCCCTGCTGCTGTC -3'
Posted On2016-04-15