Incidental Mutation 'R4931:Aldh1b1'
ID380546
Institutional Source Beutler Lab
Gene Symbol Aldh1b1
Ensembl Gene ENSMUSG00000035561
Gene Namealdehyde dehydrogenase 1 family, member B1
Synonyms
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45799022-45804604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45803661 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 400 (I400L)
Ref Sequence ENSEMBL: ENSMUSP00000041260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044384] [ENSMUST00000172750]
Predicted Effect probably benign
Transcript: ENSMUST00000044384
AA Change: I400L

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041260
Gene: ENSMUSG00000035561
AA Change: I400L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Aldedh 47 510 1.5e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172750
SMART Domains Protein: ENSMUSP00000134082
Gene: ENSMUSG00000035561

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Aldedh 47 132 1.4e-23 PFAM
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. This gene does not contain introns in the coding sequence. The variation of this locus may affect the development of alcohol-related problems. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased fasting circulating glucose levels and decreased blood acetaldehyde clearance. Mice homozygous for a different knock-out allele display defects in beta cell development and functionality, and develop glucose intolerance, age-dependent hyperglycemia, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Aldh1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Aldh1b1 APN 4 45803472 missense possibly damaging 0.87
R0557:Aldh1b1 UTSW 4 45802647 missense probably benign 0.00
R1203:Aldh1b1 UTSW 4 45803359 missense probably damaging 1.00
R1807:Aldh1b1 UTSW 4 45802873 missense possibly damaging 0.69
R1939:Aldh1b1 UTSW 4 45802755 missense possibly damaging 0.53
R4722:Aldh1b1 UTSW 4 45803472 missense probably damaging 1.00
R4847:Aldh1b1 UTSW 4 45802625 missense possibly damaging 0.92
R4871:Aldh1b1 UTSW 4 45803383 missense probably benign 0.00
R4994:Aldh1b1 UTSW 4 45803128 missense possibly damaging 0.90
R5071:Aldh1b1 UTSW 4 45803383 unclassified probably null
R5216:Aldh1b1 UTSW 4 45803652 missense probably damaging 1.00
R5582:Aldh1b1 UTSW 4 45802750 missense probably damaging 1.00
R6077:Aldh1b1 UTSW 4 45802525 missense possibly damaging 0.92
R6640:Aldh1b1 UTSW 4 45803868 missense possibly damaging 0.92
R6692:Aldh1b1 UTSW 4 45803427 missense probably damaging 1.00
R7055:Aldh1b1 UTSW 4 45802909 missense possibly damaging 0.84
Z1088:Aldh1b1 UTSW 4 45802539 missense probably benign 0.06
Z1088:Aldh1b1 UTSW 4 45802540 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGAAGAGTCCATCTACCGTG -3'
(R):5'- GCGTGAAGTAGATGGCCTTGTC -3'

Sequencing Primer
(F):5'- CTACCGTGAGTTTCTCGAGAGAAC -3'
(R):5'- CTTGTCCAGGTCTCGGGTGAAC -3'
Posted On2016-04-15