Incidental Mutation 'R4992:Lims1'
ID386273
Institutional Source Beutler Lab
Gene Symbol Lims1
Ensembl Gene ENSMUSG00000019920
Gene NameLIM and senescent cell antigen-like domains 1
Synonyms4921524A02Rik, PINCH1, C430041B13Rik, Lims1l, 2310016J22Rik
MMRRC Submission 042586-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4992 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58323466-58424691 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 58410241 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020077] [ENSMUST00000020078] [ENSMUST00000105468]
Predicted Effect probably benign
Transcript: ENSMUST00000020077
SMART Domains Protein: ENSMUSP00000020077
Gene: ENSMUSG00000019920

DomainStartEndE-ValueType
LIM 71 124 3.78e-15 SMART
LIM 132 183 5.35e-15 SMART
LIM 196 246 1.01e-10 SMART
LIM 254 305 2.84e-19 SMART
LIM 313 365 3.84e-16 SMART
low complexity region 371 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000020078
SMART Domains Protein: ENSMUSP00000020078
Gene: ENSMUSG00000019920

DomainStartEndE-ValueType
LIM 21 74 3.78e-15 SMART
LIM 82 133 5.35e-15 SMART
LIM 146 196 1.01e-10 SMART
LIM 204 255 2.84e-19 SMART
LIM 263 315 5.51e-17 SMART
low complexity region 317 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105468
SMART Domains Protein: ENSMUSP00000101108
Gene: ENSMUSG00000019920

DomainStartEndE-ValueType
LIM 71 124 3.78e-15 SMART
LIM 132 183 5.35e-15 SMART
LIM 196 246 1.01e-10 SMART
LIM 254 305 2.84e-19 SMART
LIM 313 365 5.51e-17 SMART
low complexity region 367 384 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124312
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adaptor protein which contains five LIM domains, or double zinc fingers. The protein is likely involved in integrin signaling through its LIM domain-mediated interaction with integrin-linked kinase, found in focal adhesion plaques. It is also thought to act as a bridge linking integrin-linked kinase to NCK adaptor protein 2, which is involved in growth factor receptor kinase signaling pathways. Its localization to the periphery of spreading cells also suggests that this protein may play a role in integrin-mediated cell adhesion or spreading. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice die shortly after implantation and have a disorganized egg cylinder by E5.5, which is degenerated by E6.5. E5.5 null embryos exhibit decreased cell proliferation and excessive cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Crocc G A 4: 141,046,666 A220V probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dennd5a A G 7: 109,894,712 S1262P probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Glmn T G 5: 107,557,301 D483A probably damaging Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mgat3 T A 15: 80,212,542 D523E probably benign Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Parp14 A T 16: 35,841,142 C1479S probably benign Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Polq T A 16: 37,061,162 N1229K possibly damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf112 T A 11: 61,452,711 I100F possibly damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Tmem55b A G 14: 50,929,233 V179A probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Ube3a T A 7: 59,284,820 D560E possibly damaging Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in Lims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0027:Lims1 UTSW 10 58418455 missense probably benign 0.00
R4271:Lims1 UTSW 10 58410204 critical splice donor site probably null
R4528:Lims1 UTSW 10 58410060 missense probably damaging 1.00
R4546:Lims1 UTSW 10 58418790 intron probably benign
R5380:Lims1 UTSW 10 58416670 missense probably damaging 0.99
R6207:Lims1 UTSW 10 58394564 missense possibly damaging 0.76
R6543:Lims1 UTSW 10 58412451 nonsense probably null
R6684:Lims1 UTSW 10 58399013 splice site probably null
R6762:Lims1 UTSW 10 58412545 missense probably damaging 1.00
R7373:Lims1 UTSW 10 58409620 missense probably damaging 1.00
R7434:Lims1 UTSW 10 58394479 missense probably benign
T0722:Lims1 UTSW 10 58418455 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGCCCATGTCATAATCGTG -3'
(R):5'- ACCTGATTTGGTGATGTTCCGC -3'

Sequencing Primer
(F):5'- TCGCCCATGTCATAATCGTGAAAAAG -3'
(R):5'- CCTTCTTCTAACACGAAAAGTTGGGG -3'
Posted On2016-05-10