Incidental Mutation 'R4992:Crocc'
ID386245
Institutional Source Beutler Lab
Gene Symbol Crocc
Ensembl Gene ENSMUSG00000040860
Gene Nameciliary rootlet coiled-coil, rootletin
Synonyms
MMRRC Submission 042586-MU
Accession Numbers

Genbank: NM_172122;MGI: 3529431

Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R4992 (G1)
Quality Score160
Status Validated
Chromosome4
Chromosomal Location141016637-141060550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141046666 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 220 (A220V)
Ref Sequence ENSEMBL: ENSMUSP00000099549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000144196] [ENSMUST00000168157]
Predicted Effect probably benign
Transcript: ENSMUST00000040222
AA Change: A56V

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860
AA Change: A56V

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097816
AA Change: A56V

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860
AA Change: A56V

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102491
AA Change: A220V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860
AA Change: A220V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
Pfam:Rootletin 158 336 9.7e-65 PFAM
low complexity region 354 381 N/A INTRINSIC
internal_repeat_2 462 479 1.77e-6 PROSPERO
low complexity region 493 514 N/A INTRINSIC
internal_repeat_3 527 557 8.63e-6 PROSPERO
internal_repeat_6 533 556 4.21e-5 PROSPERO
low complexity region 561 575 N/A INTRINSIC
low complexity region 576 594 N/A INTRINSIC
low complexity region 617 638 N/A INTRINSIC
low complexity region 788 807 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 1009 1039 N/A INTRINSIC
internal_repeat_4 1050 1068 4.21e-5 PROSPERO
internal_repeat_7 1057 1070 9.31e-5 PROSPERO
internal_repeat_2 1057 1074 1.77e-6 PROSPERO
internal_repeat_4 1061 1078 4.21e-5 PROSPERO
internal_repeat_1 1076 1101 3.36e-8 PROSPERO
internal_repeat_7 1192 1205 9.31e-5 PROSPERO
low complexity region 1271 1288 N/A INTRINSIC
internal_repeat_5 1302 1328 4.21e-5 PROSPERO
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1434 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
internal_repeat_6 1697 1720 4.21e-5 PROSPERO
low complexity region 1723 1740 N/A INTRINSIC
coiled coil region 1744 1871 N/A INTRINSIC
coiled coil region 1892 1996 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126863
Predicted Effect probably benign
Transcript: ENSMUST00000144196
SMART Domains Protein: ENSMUSP00000120555
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
coiled coil region 1 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168157
AA Change: A56V

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860
AA Change: A56V

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show no apparent functional deficits in phototransduction and ciliary beating in sensory and motile cilia. However, photoreceptors degenerate over time, and lungs appear prone to pathological changes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dennd5a A G 7: 109,894,712 S1262P probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Glmn T G 5: 107,557,301 D483A probably damaging Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Lims1 A C 10: 58,410,241 probably benign Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mgat3 T A 15: 80,212,542 D523E probably benign Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Parp14 A T 16: 35,841,142 C1479S probably benign Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Polq T A 16: 37,061,162 N1229K possibly damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf112 T A 11: 61,452,711 I100F possibly damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Tmem55b A G 14: 50,929,233 V179A probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Ube3a T A 7: 59,284,820 D560E possibly damaging Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in Crocc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Crocc APN 4 141022112 missense probably damaging 1.00
IGL01474:Crocc APN 4 141035392 splice site probably benign
IGL01859:Crocc APN 4 141029290 missense probably benign 0.07
IGL02161:Crocc APN 4 141033991 missense probably benign 0.01
IGL02244:Crocc APN 4 141037920 missense probably benign 0.00
IGL02970:Crocc APN 4 141030246 missense possibly damaging 0.49
N/A:Crocc UTSW 4 141021746 missense probably damaging 1.00
R0158:Crocc UTSW 4 141042242 splice site probably benign
R0280:Crocc UTSW 4 141028426 missense probably damaging 1.00
R0448:Crocc UTSW 4 141042191 missense probably damaging 1.00
R0532:Crocc UTSW 4 141030247 missense possibly damaging 0.95
R0597:Crocc UTSW 4 141019913 missense probably benign 0.06
R0597:Crocc UTSW 4 141017071 missense probably benign
R0761:Crocc UTSW 4 141029776 missense probably benign 0.00
R0761:Crocc UTSW 4 141047076 missense probably benign 0.01
R1238:Crocc UTSW 4 141035364 missense probably benign 0.00
R1460:Crocc UTSW 4 141029240 nonsense probably null
R1515:Crocc UTSW 4 141019737 missense probably benign 0.00
R1557:Crocc UTSW 4 141025465 missense probably damaging 0.96
R1561:Crocc UTSW 4 141030268 missense probably damaging 1.00
R1641:Crocc UTSW 4 141017077 missense probably benign 0.00
R1709:Crocc UTSW 4 141026099 critical splice donor site probably null
R1785:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1786:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1793:Crocc UTSW 4 141019309 missense probably damaging 1.00
R1897:Crocc UTSW 4 141018736 missense probably damaging 1.00
R1935:Crocc UTSW 4 141034058 missense possibly damaging 0.78
R2037:Crocc UTSW 4 141046942 critical splice donor site probably null
R2127:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2129:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2130:Crocc UTSW 4 141029102 missense probably benign 0.04
R2136:Crocc UTSW 4 141032954 missense probably damaging 1.00
R2298:Crocc UTSW 4 141025459 missense probably benign 0.30
R2847:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2848:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2913:Crocc UTSW 4 141020350 missense probably damaging 1.00
R3415:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3416:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3417:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R4082:Crocc UTSW 4 141033971 splice site probably null
R4454:Crocc UTSW 4 141020405 missense possibly damaging 0.52
R4591:Crocc UTSW 4 141018672 missense probably damaging 1.00
R4597:Crocc UTSW 4 141019777 missense probably damaging 1.00
R4984:Crocc UTSW 4 141034452 missense probably damaging 1.00
R5109:Crocc UTSW 4 141028411 missense probably damaging 1.00
R5143:Crocc UTSW 4 141041039 missense probably benign 0.01
R5381:Crocc UTSW 4 141029311 missense possibly damaging 0.95
R5684:Crocc UTSW 4 141051144 missense probably damaging 0.99
R5757:Crocc UTSW 4 141043564 missense probably damaging 1.00
R5795:Crocc UTSW 4 141041807 frame shift probably null
R5796:Crocc UTSW 4 141041807 frame shift probably null
R5798:Crocc UTSW 4 141041807 frame shift probably null
R5815:Crocc UTSW 4 141035196 missense probably damaging 0.99
R5955:Crocc UTSW 4 141017918 missense possibly damaging 0.75
R6031:Crocc UTSW 4 141034357 critical splice donor site probably null
R6063:Crocc UTSW 4 141041721 missense probably benign 0.08
R6063:Crocc UTSW 4 141046540 missense probably damaging 1.00
R7086:Crocc UTSW 4 141047057 missense possibly damaging 0.47
R7282:Crocc UTSW 4 141022341 missense probably damaging 1.00
R7293:Crocc UTSW 4 141043556 missense probably benign 0.17
R7404:Crocc UTSW 4 141026186 missense possibly damaging 0.46
R7571:Crocc UTSW 4 141046049 critical splice acceptor site probably null
X0065:Crocc UTSW 4 141041792 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- ACTGGTCACCTTGCGTATGTC -3'
(R):5'- TTCTGCAGTACAAGAAGCAGTG -3'

Sequencing Primer
(F):5'- GTATGTCCTCGCTCAGAGC -3'
(R):5'- AGCAGTGCTCAGAGCTGG -3'
Posted On2016-05-10