Incidental Mutation 'R5062:Cpne9'
ID386680
Institutional Source Beutler Lab
Gene Symbol Cpne9
Ensembl Gene ENSMUSG00000030270
Gene Namecopine family member IX
Synonyms
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R5062 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113282307-113305627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113304488 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 510 (M510K)
Ref Sequence ENSEMBL: ENSMUSP00000044416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041203] [ENSMUST00000113117] [ENSMUST00000113119] [ENSMUST00000113121] [ENSMUST00000113122] [ENSMUST00000130191] [ENSMUST00000203577] [ENSMUST00000204198] [ENSMUST00000204626]
Predicted Effect probably damaging
Transcript: ENSMUST00000041203
AA Change: M510K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044416
Gene: ENSMUSG00000030270
AA Change: M510K

DomainStartEndE-ValueType
C2 14 122 2.12e-10 SMART
C2 143 257 5.15e-9 SMART
VWA 297 495 4.4e-10 SMART
low complexity region 536 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113117
SMART Domains Protein: ENSMUSP00000108742
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 1e-35 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
low complexity region 1078 1090 N/A INTRINSIC
PWWP 1115 1198 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113119
SMART Domains Protein: ENSMUSP00000108744
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 8.5e-39 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
PWWP 1116 1199 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113121
SMART Domains Protein: ENSMUSP00000108746
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
PWWP 1082 1165 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113122
SMART Domains Protein: ENSMUSP00000108747
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
PWWP 1081 1164 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203569
Predicted Effect probably benign
Transcript: ENSMUST00000203577
SMART Domains Protein: ENSMUSP00000144820
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 5.1e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
low complexity region 1084 1096 N/A INTRINSIC
PWWP 1121 1204 2.6e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204198
SMART Domains Protein: ENSMUSP00000144804
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.4e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1e-39 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 899 925 N/A INTRINSIC
PWWP 987 1070 2.6e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204626
SMART Domains Protein: ENSMUSP00000145093
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.9e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
PWWP 1087 1170 2.6e-44 SMART
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Cpne9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Cpne9 APN 6 113293022 missense possibly damaging 0.54
IGL02318:Cpne9 APN 6 113293738 missense possibly damaging 0.74
IGL02800:Cpne9 APN 6 113302073 missense probably benign 0.40
IGL02819:Cpne9 APN 6 113300663 missense probably damaging 0.99
IGL03111:Cpne9 APN 6 113300610 missense possibly damaging 0.79
PIT4366001:Cpne9 UTSW 6 113294746 missense probably damaging 1.00
R0145:Cpne9 UTSW 6 113300601 missense probably damaging 0.97
R0319:Cpne9 UTSW 6 113294693 missense probably damaging 1.00
R0514:Cpne9 UTSW 6 113290013 missense probably damaging 0.98
R0586:Cpne9 UTSW 6 113295063 missense probably damaging 0.96
R0594:Cpne9 UTSW 6 113290400 splice site probably benign
R1464:Cpne9 UTSW 6 113294737 missense probably damaging 1.00
R1464:Cpne9 UTSW 6 113294737 missense probably damaging 1.00
R4184:Cpne9 UTSW 6 113282457 unclassified probably benign
R4243:Cpne9 UTSW 6 113283023 unclassified probably benign
R4256:Cpne9 UTSW 6 113283023 unclassified probably benign
R4258:Cpne9 UTSW 6 113283023 unclassified probably benign
R4412:Cpne9 UTSW 6 113290001 missense possibly damaging 0.78
R4690:Cpne9 UTSW 6 113302055 missense probably damaging 1.00
R5249:Cpne9 UTSW 6 113293073 splice site probably benign
R5437:Cpne9 UTSW 6 113304630 unclassified probably benign
R5523:Cpne9 UTSW 6 113290231 missense probably damaging 1.00
R5979:Cpne9 UTSW 6 113293749 missense probably benign 0.44
R6207:Cpne9 UTSW 6 113294773 missense possibly damaging 0.88
R6849:Cpne9 UTSW 6 113302118 missense probably damaging 0.98
R6989:Cpne9 UTSW 6 113300583 missense possibly damaging 0.95
R7376:Cpne9 UTSW 6 113290013 missense probably damaging 0.98
R7524:Cpne9 UTSW 6 113302064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCAGAAGGATGACATTCAAG -3'
(R):5'- TTAACTTCCAGCAGTGGGTAGAC -3'

Sequencing Primer
(F):5'- TACAGTGAAGCTAAAGAGACTCTC -3'
(R):5'- GTAGACAGGTAAGCAGACTGC -3'
Posted On2016-06-06