Incidental Mutation 'R5062:Peak1'
ID386695
Institutional Source Beutler Lab
Gene Symbol Peak1
Ensembl Gene ENSMUSG00000074305
Gene Namepseudopodium-enriched atypical kinase 1
SynonymsC230081A13Rik, NKF3 kinase family member, 1110049L02Rik
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R5062 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56201126-56418067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56260289 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 118 (N118K)
Ref Sequence ENSEMBL: ENSMUSP00000109901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000186735]
Predicted Effect probably damaging
Transcript: ENSMUST00000061552
AA Change: N118K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: N118K

DomainStartEndE-ValueType
low complexity region 247 259 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Pfam:Pkinase_Tyr 1437 1649 1.5e-6 PFAM
Pfam:Pkinase 1440 1651 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181444
Predicted Effect probably benign
Transcript: ENSMUST00000186735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192330
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Peak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Peak1 APN 9 56227326 missense probably damaging 1.00
IGL00544:Peak1 APN 9 56259978 missense probably damaging 1.00
IGL01141:Peak1 APN 9 56258527 missense probably benign 0.01
IGL01743:Peak1 APN 9 56259202 missense probably damaging 1.00
IGL01781:Peak1 APN 9 56260065 missense possibly damaging 0.92
IGL01885:Peak1 APN 9 56260104 missense probably damaging 1.00
IGL01941:Peak1 APN 9 56258775 missense probably damaging 1.00
IGL02455:Peak1 APN 9 56227473 missense possibly damaging 0.89
IGL02719:Peak1 APN 9 56227206 missense probably damaging 1.00
IGL03247:Peak1 APN 9 56257930 missense probably damaging 1.00
IGL03259:Peak1 APN 9 56259967 missense probably damaging 1.00
R0060:Peak1 UTSW 9 56227823 missense probably damaging 1.00
R0087:Peak1 UTSW 9 56258325 missense probably damaging 1.00
R0480:Peak1 UTSW 9 56258632 missense probably benign 0.00
R0569:Peak1 UTSW 9 56260089 missense probably damaging 1.00
R0605:Peak1 UTSW 9 56227098 splice site probably benign
R0865:Peak1 UTSW 9 56257832 missense probably benign 0.02
R1117:Peak1 UTSW 9 56258418 missense probably benign 0.05
R1922:Peak1 UTSW 9 56206687 missense probably damaging 1.00
R1959:Peak1 UTSW 9 56206789 missense probably damaging 1.00
R2069:Peak1 UTSW 9 56258759 missense probably damaging 1.00
R2083:Peak1 UTSW 9 56258949 missense probably damaging 1.00
R2154:Peak1 UTSW 9 56207212 missense probably damaging 1.00
R2407:Peak1 UTSW 9 56259226 missense probably damaging 1.00
R3832:Peak1 UTSW 9 56258383 missense probably benign
R3938:Peak1 UTSW 9 56260365 missense probably benign 0.01
R3964:Peak1 UTSW 9 56259979 missense probably damaging 1.00
R4192:Peak1 UTSW 9 56258741 missense probably damaging 1.00
R4381:Peak1 UTSW 9 56258427 missense probably benign 0.34
R4869:Peak1 UTSW 9 56227592 missense probably benign 0.06
R4994:Peak1 UTSW 9 56241276 missense possibly damaging 0.65
R5435:Peak1 UTSW 9 56206486 missense probably damaging 0.98
R5632:Peak1 UTSW 9 56257774 missense probably damaging 1.00
R5643:Peak1 UTSW 9 56258755 missense probably damaging 0.99
R5880:Peak1 UTSW 9 56207610 missense probably damaging 1.00
R5898:Peak1 UTSW 9 56207338 missense probably benign 0.19
R5986:Peak1 UTSW 9 56259442 missense probably benign 0.00
R6109:Peak1 UTSW 9 56259283 missense probably benign 0.01
R6284:Peak1 UTSW 9 56260296 missense probably benign 0.10
R6347:Peak1 UTSW 9 56258211 missense probably benign 0.00
R6374:Peak1 UTSW 9 56257666 missense probably damaging 1.00
R6471:Peak1 UTSW 9 56258259 missense probably damaging 1.00
R6717:Peak1 UTSW 9 56207239 missense probably benign 0.00
R7033:Peak1 UTSW 9 56259707 missense probably damaging 1.00
R7039:Peak1 UTSW 9 56257809 missense probably benign 0.01
R7100:Peak1 UTSW 9 56259393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGAATGTTTCTCTGGCG -3'
(R):5'- GCAGTGGGAAAACTAATGCC -3'

Sequencing Primer
(F):5'- GTTTGTTTCATTTCCTCTGACCGGAG -3'
(R):5'- TCAGGAGCACGGGCAACTTC -3'
Posted On2016-06-06