Incidental Mutation 'R5033:Pcnt'
ID389380
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Namepericentrin (kendrin)
Synonymsm239Asp, m275Asp, Pcnt2
MMRRC Submission 042624-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5033 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76351263-76442786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76399945 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1401 (C1401S)
Ref Sequence ENSEMBL: ENSMUSP00000151534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001179
AA Change: C1401S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: C1401S

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190491
Predicted Effect possibly damaging
Transcript: ENSMUST00000217838
AA Change: C1401S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220395
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,279,414 V149A probably benign Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4931406P16Rik C T 7: 34,245,812 G336S probably benign Het
9930111J21Rik1 G A 11: 48,947,706 R685W probably damaging Het
Arhgap10 A T 8: 77,382,757 L399H probably damaging Het
Arih2 AGCCG AG 9: 108,611,660 probably benign Het
Atp13a2 A G 4: 141,000,821 H575R possibly damaging Het
Bbof1 G A 12: 84,411,270 probably null Het
Catsperg2 A C 7: 29,710,134 Y545D possibly damaging Het
Cdc42bpa T A 1: 180,065,015 I248N probably damaging Het
Cdk11b A T 4: 155,648,825 probably benign Het
Cfap46 C A 7: 139,603,860 L90F probably benign Het
Cndp2 A G 18: 84,670,829 L276P possibly damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Daam1 C A 12: 71,946,520 H354Q unknown Het
Dnah5 T A 15: 28,421,678 F3892Y probably damaging Het
Dnajb3 A G 1: 88,205,023 V219A possibly damaging Het
Drd5 A G 5: 38,320,201 H179R probably damaging Het
Dym A G 18: 75,119,161 N333D possibly damaging Het
Eif2b3 A G 4: 117,052,736 D156G probably damaging Het
Emc1 A G 4: 139,371,696 D830G probably damaging Het
F13a1 A C 13: 36,988,856 I183M probably damaging Het
Fam136b-ps T A 15: 31,276,897 probably benign Het
Fdft1 C A 14: 63,163,404 K93N probably damaging Het
Gcc2 A G 10: 58,278,806 D959G probably damaging Het
Gm14085 T A 2: 122,522,914 probably null Het
Gm853 C T 4: 130,221,615 probably null Het
Gp2 A G 7: 119,454,291 V149A probably damaging Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Hdac9 A T 12: 34,373,907 C587S probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Iars2 A G 1: 185,317,928 V453A possibly damaging Het
Il1r1 T G 1: 40,293,524 C121W probably damaging Het
Jazf1 A G 6: 52,777,540 Y184H probably damaging Het
Kel A T 6: 41,699,055 Y234N probably damaging Het
Khk G A 5: 30,929,660 G186D probably damaging Het
Klf4 A T 4: 55,530,301 M270K probably benign Het
Kmt2c G A 5: 25,314,708 L2135F probably benign Het
Krtap15 A G 16: 88,829,156 Y37C probably damaging Het
Lars A G 18: 42,214,776 F994S possibly damaging Het
Lrp8 T C 4: 107,834,755 probably null Het
Lrrc2 A T 9: 110,980,919 D341V probably damaging Het
Map4k4 A G 1: 40,007,502 K646R probably damaging Het
Mrps9 T A 1: 42,895,331 probably null Het
Olfr1130 T A 2: 87,607,711 C108S probably damaging Het
Olfr745 T A 14: 50,643,162 Y288N probably damaging Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pdgfrb A T 18: 61,077,668 K749M probably damaging Het
Pigo A T 4: 43,019,412 W969R probably null Het
Pigr A T 1: 130,844,699 Y218F probably damaging Het
Pih1d1 A G 7: 45,154,854 probably benign Het
Pik3cg A T 12: 32,199,196 probably null Het
Pik3r6 A T 11: 68,533,468 K300* probably null Het
Pip5k1c A G 10: 81,305,250 D64G probably damaging Het
Piwil2 A T 14: 70,421,593 I161K possibly damaging Het
Pou3f1 A G 4: 124,658,656 E317G probably damaging Het
Prdm8 C T 5: 98,185,212 Q213* probably null Het
Prpf6 T A 2: 181,650,106 C739S possibly damaging Het
Psmc3 T A 2: 91,054,608 S40T probably benign Het
Psmd3 A T 11: 98,682,824 D32V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rapgef6 A T 11: 54,691,381 H1373L possibly damaging Het
Rnf207 A C 4: 152,313,209 S328A probably benign Het
Ros1 C T 10: 52,128,416 probably null Het
Ryr2 T A 13: 11,587,254 I4581F possibly damaging Het
Sacm1l C T 9: 123,586,399 R480W probably damaging Het
Sec16a A G 2: 26,419,649 V664A probably benign Het
Selenoo T A 15: 89,092,766 M207K probably damaging Het
Sh3tc2 G A 18: 62,014,891 probably null Het
Slco2b1 G T 7: 99,660,049 Q692K probably benign Het
Slfn4 A T 11: 83,186,797 D137V probably damaging Het
Srrm2 G A 17: 23,820,618 A2175T probably damaging Het
Stard9 T A 2: 120,693,399 C692S probably benign Het
Sulf2 T A 2: 166,081,622 D559V probably benign Het
Tbpl2 T C 2: 24,087,158 I283V probably benign Het
Tmem19 A G 10: 115,359,761 F46S probably benign Het
Trp63 T A 16: 25,763,306 Y35N probably damaging Het
Ttn T A 2: 76,886,442 probably benign Het
Ube2z A T 11: 96,050,322 H331Q probably benign Het
Ubr1 C T 2: 120,911,997 probably null Het
Uhrf1bp1 A G 17: 27,886,864 E788G probably damaging Het
Vmn1r235 A T 17: 21,262,288 I292F possibly damaging Het
Vmn2r1 T A 3: 64,105,080 D787E probably damaging Het
Vmn2r3 A G 3: 64,259,799 V637A probably benign Het
Xpnpep1 C A 19: 53,006,175 V341L probably benign Het
Yme1l1 A G 2: 23,194,747 D619G probably damaging Het
Zfp597 G A 16: 3,866,638 P85S probably damaging Het
Zscan20 A G 4: 128,586,128 S857P probably benign Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76422904 nonsense probably null
IGL01307:Pcnt APN 10 76411588 missense probably damaging 1.00
IGL01549:Pcnt APN 10 76367486 splice site probably null
IGL01576:Pcnt APN 10 76368822 missense probably damaging 0.99
IGL01611:Pcnt APN 10 76436424 critical splice donor site probably null
IGL01630:Pcnt APN 10 76420246 missense probably damaging 0.99
IGL01647:Pcnt APN 10 76370001 nonsense probably null
IGL01689:Pcnt APN 10 76411653 missense probably damaging 1.00
IGL01690:Pcnt APN 10 76392775 missense probably damaging 1.00
IGL01723:Pcnt APN 10 76418499 missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76404528 missense probably damaging 1.00
IGL01958:Pcnt APN 10 76433679 missense probably damaging 0.96
IGL02210:Pcnt APN 10 76389219 missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02228:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02237:Pcnt APN 10 76352984 missense probably damaging 1.00
IGL02279:Pcnt APN 10 76403765 missense probably damaging 1.00
IGL02303:Pcnt APN 10 76442559 splice site probably benign
IGL02355:Pcnt APN 10 76375162 nonsense probably null
IGL02362:Pcnt APN 10 76375162 nonsense probably null
IGL02428:Pcnt APN 10 76429256 missense probably damaging 0.99
IGL02536:Pcnt APN 10 76380229 missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76368722 splice site probably benign
IGL02800:Pcnt APN 10 76412583 nonsense probably null
IGL03395:Pcnt APN 10 76436491 missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76412583 nonsense probably null
PIT4520001:Pcnt UTSW 10 76420235 missense probably damaging 0.99
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0109:Pcnt UTSW 10 76389196 missense probably benign 0.00
R0117:Pcnt UTSW 10 76408727 nonsense probably null
R0254:Pcnt UTSW 10 76392580 missense probably benign 0.10
R0392:Pcnt UTSW 10 76384826 missense probably benign
R0511:Pcnt UTSW 10 76404595 missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76412107 missense probably damaging 1.00
R0614:Pcnt UTSW 10 76420316 missense probably damaging 1.00
R0635:Pcnt UTSW 10 76404585 missense probably damaging 1.00
R0707:Pcnt UTSW 10 76420541 missense probably damaging 1.00
R0749:Pcnt UTSW 10 76381364 missense probably damaging 1.00
R0969:Pcnt UTSW 10 76427951 missense probably damaging 1.00
R1172:Pcnt UTSW 10 76393044 splice site probably null
R1174:Pcnt UTSW 10 76393044 splice site probably null
R1175:Pcnt UTSW 10 76393044 splice site probably null
R1512:Pcnt UTSW 10 76404662 splice site probably null
R1542:Pcnt UTSW 10 76389387 missense probably benign 0.08
R1542:Pcnt UTSW 10 76401386 missense probably benign 0.02
R1558:Pcnt UTSW 10 76422922 missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76367330 missense probably benign 0.02
R1762:Pcnt UTSW 10 76355137 critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76408796 missense probably damaging 0.99
R1869:Pcnt UTSW 10 76379906 missense probably null 0.94
R1911:Pcnt UTSW 10 76368816 missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76380337 missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76392799 nonsense probably null
R2073:Pcnt UTSW 10 76380380 missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2112:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2309:Pcnt UTSW 10 76442626 start gained probably benign
R2902:Pcnt UTSW 10 76375230 missense probably damaging 0.98
R3623:Pcnt UTSW 10 76433750 missense probably benign 0.23
R4088:Pcnt UTSW 10 76428014 missense probably damaging 1.00
R4300:Pcnt UTSW 10 76367391 missense probably benign 0.40
R4402:Pcnt UTSW 10 76392393 missense probably benign 0.00
R4407:Pcnt UTSW 10 76374870 missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76401483 missense probably damaging 1.00
R4647:Pcnt UTSW 10 76354213 missense probably benign 0.01
R4734:Pcnt UTSW 10 76437206 missense probably benign 0.25
R4747:Pcnt UTSW 10 76436465 missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76409577 missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76370024 missense probably benign 0.21
R4831:Pcnt UTSW 10 76412501 missense probably damaging 0.96
R4873:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4875:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4946:Pcnt UTSW 10 76356185 missense probably damaging 1.00
R5032:Pcnt UTSW 10 76355077 missense probably benign 0.00
R5106:Pcnt UTSW 10 76401444 missense probably damaging 1.00
R5118:Pcnt UTSW 10 76412168 missense probably damaging 0.98
R5167:Pcnt UTSW 10 76420424 missense probably damaging 0.97
R5199:Pcnt UTSW 10 76418544 missense probably benign 0.09
R5223:Pcnt UTSW 10 76380272 missense probably damaging 0.99
R5241:Pcnt UTSW 10 76433617 missense probably benign 0.26
R5308:Pcnt UTSW 10 76356325 nonsense probably null
R5328:Pcnt UTSW 10 76411719 missense probably damaging 1.00
R5454:Pcnt UTSW 10 76389547 splice site probably null
R5543:Pcnt UTSW 10 76412052 missense probably benign 0.01
R5588:Pcnt UTSW 10 76442611 missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76385841 missense probably benign 0.17
R5668:Pcnt UTSW 10 76409500 missense probably benign 0.16
R5712:Pcnt UTSW 10 76429271 missense probably damaging 0.96
R5714:Pcnt UTSW 10 76420491 missense probably damaging 1.00
R5797:Pcnt UTSW 10 76392756 missense probably benign 0.00
R5946:Pcnt UTSW 10 76382063 missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76411622 missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76420037 missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76385798 missense probably benign 0.02
R6485:Pcnt UTSW 10 76389330 nonsense probably null
R6605:Pcnt UTSW 10 76429198 critical splice donor site probably null
R6877:Pcnt UTSW 10 76434017 missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76427828 missense probably benign 0.00
R6919:Pcnt UTSW 10 76385798 missense probably benign 0.02
R7025:Pcnt UTSW 10 76403835 missense probably damaging 1.00
R7098:Pcnt UTSW 10 76384839 missense probably benign
R7109:Pcnt UTSW 10 76369904 missense probably damaging 1.00
R7121:Pcnt UTSW 10 76427927 missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76389060 missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76411360 intron probably null
R7213:Pcnt UTSW 10 76408904 missense probably damaging 1.00
R7368:Pcnt UTSW 10 76400001 missense probably benign
R7453:Pcnt UTSW 10 76389450 missense probably benign
R7486:Pcnt UTSW 10 76418436 missense probably benign 0.03
R7486:Pcnt UTSW 10 76418437 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAAACTCTGGCCACAGTGCTG -3'
(R):5'- ACTTCTGCAGGAGACCTCATG -3'

Sequencing Primer
(F):5'- ATGGTGAGCCTTTATGCAGAAG -3'
(R):5'- GGAGACCTCATGCTGGCTTATAAC -3'
Posted On2016-06-06