Incidental Mutation 'R5135:Sema6a'
ID396172
Institutional Source Beutler Lab
Gene Symbol Sema6a
Ensembl Gene ENSMUSG00000019647
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonymssema, Sema6A-1, Semaq, A730020P05Rik, VIa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5135 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location47235598-47368870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47291172 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 223 (V223A)
Ref Sequence ENSEMBL: ENSMUSP00000121442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019791] [ENSMUST00000076043] [ENSMUST00000115449] [ENSMUST00000126684] [ENSMUST00000135790] [ENSMUST00000156422]
Predicted Effect probably damaging
Transcript: ENSMUST00000019791
AA Change: V223A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019791
Gene: ENSMUSG00000019647
AA Change: V223A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076043
AA Change: V223A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075420
Gene: ENSMUSG00000019647
AA Change: V223A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 593 615 N/A INTRINSIC
low complexity region 877 896 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115449
AA Change: V223A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111109
Gene: ENSMUSG00000019647
AA Change: V223A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 461 1.24e-168 SMART
PSI 488 543 9.57e-1 SMART
transmembrane domain 622 644 N/A INTRINSIC
low complexity region 906 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126684
SMART Domains Protein: ENSMUSP00000118655
Gene: ENSMUSG00000019647

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 56 216 2.5e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135790
AA Change: V223A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120011
Gene: ENSMUSG00000019647
AA Change: V223A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151382
Predicted Effect probably damaging
Transcript: ENSMUST00000156422
AA Change: V223A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121442
Gene: ENSMUSG00000019647
AA Change: V223A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transmembrane semaphorin SEMA6A is expressed in developing neural tissue and is required for proper development of the thalamocortical projection (Leighton et al., 2001 [PubMed 11242070]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit defects in lamina-specific neurite stratification of specific retinal neuron subtypes and disruption of the dendritic plexus organization of On but not Off starburst amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T C 1: 184,033,506 S119G probably benign Het
4930553M12Rik G T 4: 88,868,271 H37N unknown Het
Adam10 T A 9: 70,766,074 C496S probably damaging Het
Akap2 G T 4: 57,855,912 A414S probably benign Het
Aldh18a1 A C 19: 40,554,817 probably benign Het
Alox5 A G 6: 116,413,786 F468S probably benign Het
Ankrd50 T C 3: 38,455,803 H805R probably damaging Het
Ap2s1 T A 7: 16,747,323 D72E probably damaging Het
Apaf1 T C 10: 91,060,094 Y372C probably damaging Het
Apob C T 12: 8,010,086 T2823I probably damaging Het
Bhmt A G 13: 93,627,323 V70A probably damaging Het
Cdc42bpg T A 19: 6,320,618 L1247H probably damaging Het
Cel A G 2: 28,559,423 V264A probably benign Het
Celsr2 T C 3: 108,398,659 N2043S probably damaging Het
Clca4a A T 3: 144,954,946 W706R probably damaging Het
Col22a1 G T 15: 71,799,337 P1058Q unknown Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dhx30 T G 9: 110,098,795 R55S probably damaging Het
Dlgap5 C T 14: 47,399,665 R452H probably damaging Het
Dnah12 T A 14: 26,770,477 D1191E probably damaging Het
Dock3 A T 9: 106,932,997 I164N probably damaging Het
Edrf1 T A 7: 133,651,044 M436K probably benign Het
Eif2ak2 T A 17: 78,866,345 Y268F probably damaging Het
Evi2a G A 11: 79,527,451 T111M possibly damaging Het
Fzd4 A G 7: 89,407,501 E252G probably damaging Het
Gcm2 A G 13: 41,102,959 V438A probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm21994 A T 2: 150,255,490 Y34* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm4846 T C 1: 166,483,982 D436G probably damaging Het
Gm5414 T A 15: 101,627,768 I141F probably damaging Het
Gm6185 T A 1: 161,198,231 noncoding transcript Het
Grip2 T C 6: 91,773,916 E776G possibly damaging Het
H2-Ob T A 17: 34,243,516 V160E probably benign Het
Hormad1 T C 3: 95,585,220 probably benign Het
Ighv2-1 A T 12: 113,574,462 probably benign Het
Igkv4-92 A T 6: 68,755,554 C14S probably benign Het
Iqsec3 T C 6: 121,383,919 I993M probably damaging Het
Kdm5b T A 1: 134,588,746 probably benign Het
Kitl T C 10: 100,088,222 probably null Het
Klhl26 G T 8: 70,452,718 R100S probably benign Het
Kpna4 C T 3: 69,092,809 probably null Het
Lama5 T A 2: 180,202,220 N383Y possibly damaging Het
Large1 T G 8: 72,818,096 I685L probably benign Het
Larp4b A G 13: 9,170,737 E590G probably damaging Het
Liph A T 16: 21,956,165 C425* probably null Het
Lrrc31 A T 3: 30,684,890 C327* probably null Het
Lrrc36 T C 8: 105,463,898 V733A probably benign Het
Mmel1 T A 4: 154,882,324 I83K probably benign Het
Myo16 G T 8: 10,476,114 V885L probably benign Het
Naip2 A T 13: 100,179,440 N277K probably damaging Het
Ncapg2 T A 12: 116,427,786 I485N possibly damaging Het
Npc1l1 A T 11: 6,224,245 Y687N possibly damaging Het
Obscn A T 11: 59,129,653 V922E probably damaging Het
Oc90 A G 15: 65,883,830 S223P probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1253 A T 2: 89,751,895 L311H possibly damaging Het
Olfr1508 T C 14: 52,463,854 I52V probably benign Het
Pdlim5 C T 3: 142,304,365 R174H probably benign Het
Pex5l G T 3: 32,955,831 A386E probably damaging Het
Plcxd1 T A 5: 110,101,363 probably benign Het
Pramef8 T G 4: 143,419,009 S349R probably benign Het
Prl8a1 A T 13: 27,579,819 probably null Het
Ryr2 G T 13: 11,662,130 N3278K probably benign Het
Sacm1l A G 9: 123,577,025 M324V probably benign Het
Sdad1 T C 5: 92,303,934 T143A probably benign Het
Sec11a A T 7: 80,923,064 probably benign Het
Serpinb6c A G 13: 33,880,097 V325A probably damaging Het
Slc4a2 G A 5: 24,430,127 A177T possibly damaging Het
Slc5a4a A G 10: 76,147,594 N22D unknown Het
Stard13 C T 5: 151,062,767 W308* probably null Het
Tanc2 C T 11: 105,857,553 L504F possibly damaging Het
Tfap2e G T 4: 126,720,544 N282K probably damaging Het
Uhrf1bp1l T C 10: 89,789,355 I48T probably damaging Het
Usp36 G T 11: 118,264,905 T682K possibly damaging Het
Zc3h11a T C 1: 133,633,789 T315A probably benign Het
Zfa-ps T A 10: 52,543,022 noncoding transcript Het
Zfp663 A T 2: 165,353,670 C210S possibly damaging Het
Zfp747 T C 7: 127,374,394 I201M probably damaging Het
Zic4 C T 9: 91,384,152 T276M probably damaging Het
Other mutations in Sema6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Sema6a APN 18 47289975 critical splice donor site probably null
IGL01351:Sema6a APN 18 47281302 missense possibly damaging 0.84
IGL01594:Sema6a APN 18 47248817 missense probably damaging 1.00
IGL01953:Sema6a APN 18 47290120 nonsense probably null
IGL02077:Sema6a APN 18 47283398 missense possibly damaging 0.94
IGL02632:Sema6a APN 18 47290155 missense probably damaging 1.00
IGL02957:Sema6a APN 18 47249224 missense probably damaging 1.00
IGL03013:Sema6a APN 18 47248394 missense probably benign 0.01
IGL03279:Sema6a APN 18 47300090 nonsense probably null
saphire UTSW 18 47306429 nonsense probably null
IGL02988:Sema6a UTSW 18 47298214 missense probably damaging 1.00
R0114:Sema6a UTSW 18 47290177 missense probably damaging 1.00
R0311:Sema6a UTSW 18 47290045 unclassified probably null
R0312:Sema6a UTSW 18 47290045 unclassified probably null
R0347:Sema6a UTSW 18 47291129 missense probably damaging 1.00
R0350:Sema6a UTSW 18 47270718 missense probably benign
R0366:Sema6a UTSW 18 47290045 unclassified probably null
R0368:Sema6a UTSW 18 47290045 unclassified probably null
R0391:Sema6a UTSW 18 47290045 unclassified probably null
R0403:Sema6a UTSW 18 47290045 unclassified probably null
R0466:Sema6a UTSW 18 47290045 unclassified probably null
R0515:Sema6a UTSW 18 47290045 unclassified probably null
R0517:Sema6a UTSW 18 47290045 unclassified probably null
R0542:Sema6a UTSW 18 47248576 missense probably damaging 1.00
R0557:Sema6a UTSW 18 47249500 missense probably benign 0.01
R0569:Sema6a UTSW 18 47270805 splice site probably null
R0650:Sema6a UTSW 18 47290045 unclassified probably null
R0689:Sema6a UTSW 18 47290045 unclassified probably null
R0694:Sema6a UTSW 18 47290045 unclassified probably null
R0726:Sema6a UTSW 18 47291981 missense probably damaging 1.00
R0741:Sema6a UTSW 18 47290045 unclassified probably null
R0821:Sema6a UTSW 18 47290045 unclassified probably null
R0824:Sema6a UTSW 18 47290045 unclassified probably null
R0924:Sema6a UTSW 18 47248492 missense probably damaging 1.00
R1108:Sema6a UTSW 18 47306431 missense probably benign 0.02
R1255:Sema6a UTSW 18 47249299 missense probably damaging 0.98
R1422:Sema6a UTSW 18 47306431 missense probably benign 0.02
R1531:Sema6a UTSW 18 47248999 missense probably damaging 1.00
R1707:Sema6a UTSW 18 47283445 missense probably benign 0.04
R1746:Sema6a UTSW 18 47306349 splice site probably benign
R1807:Sema6a UTSW 18 47276424 missense possibly damaging 0.85
R1974:Sema6a UTSW 18 47270629 missense probably benign 0.04
R1987:Sema6a UTSW 18 47300142 missense probably damaging 1.00
R2044:Sema6a UTSW 18 47306429 nonsense probably null
R3719:Sema6a UTSW 18 47249077 missense probably damaging 1.00
R4491:Sema6a UTSW 18 47306457 utr 5 prime probably benign
R4552:Sema6a UTSW 18 47291923 missense probably damaging 1.00
R4707:Sema6a UTSW 18 47248712 missense probably benign 0.43
R4710:Sema6a UTSW 18 47270683 missense probably benign 0.00
R4713:Sema6a UTSW 18 47249296 missense possibly damaging 0.79
R4963:Sema6a UTSW 18 47298251 missense possibly damaging 0.48
R5088:Sema6a UTSW 18 47249129 missense probably damaging 1.00
R5133:Sema6a UTSW 18 47300128 missense probably damaging 1.00
R5141:Sema6a UTSW 18 47248388 missense probably damaging 1.00
R5277:Sema6a UTSW 18 47276544 intron probably benign
R5551:Sema6a UTSW 18 47248528 missense possibly damaging 0.76
R5618:Sema6a UTSW 18 47281948 missense probably damaging 0.98
R5717:Sema6a UTSW 18 47249263 missense probably benign 0.01
R5729:Sema6a UTSW 18 47281343 missense probably damaging 1.00
R5779:Sema6a UTSW 18 47248826 missense probably damaging 1.00
R5917:Sema6a UTSW 18 47281338 missense probably benign 0.05
R6054:Sema6a UTSW 18 47283403 missense possibly damaging 0.94
R6142:Sema6a UTSW 18 47281199 missense probably benign 0.00
R6209:Sema6a UTSW 18 47298302 splice site probably null
R6307:Sema6a UTSW 18 47249164 missense probably damaging 1.00
R6734:Sema6a UTSW 18 47279169 missense probably benign 0.31
X0065:Sema6a UTSW 18 47283319 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACAGCTTAGTCTGTCACTTCTGG -3'
(R):5'- TTCTGAAATCACTAGCGCTTGC -3'

Sequencing Primer
(F):5'- TCATCGGGTTCAATTTGCATTTCCAG -3'
(R):5'- AGCGCTTGCACTTCTGAAG -3'
Posted On2016-06-21