Incidental Mutation 'R5185:Cfap43'
ID397851
Institutional Source Beutler Lab
Gene Symbol Cfap43
Ensembl Gene ENSMUSG00000044948
Gene Namecilia and flagella associated protein 43
Synonyms4930463G05Rik, D19Ertd652e, 4632415N18Rik, 4930428C11Rik, Wdr96
MMRRC Submission 042764-MU
Accession Numbers

Genbank: NM_027559

Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5185 (G1)
Quality Score203
Status Validated
Chromosome19
Chromosomal Location47737561-47919299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47780394 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 737 (I737T)
Ref Sequence ENSEMBL: ENSMUSP00000125007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160247]
Predicted Effect probably benign
Transcript: ENSMUST00000160247
AA Change: I737T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948
AA Change: I737T

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Blast:WD40 70 111 6e-7 BLAST
Blast:WD40 115 156 1e-5 BLAST
Blast:WD40 162 197 8e-10 BLAST
WD40 349 388 1.07e0 SMART
Blast:WD40 392 432 3e-13 BLAST
WD40 435 473 3.96e1 SMART
WD40 479 518 3.82e1 SMART
Blast:WD40 638 683 8e-17 BLAST
Blast:WD40 689 728 1e-17 BLAST
low complexity region 766 781 N/A INTRINSIC
coiled coil region 855 886 N/A INTRINSIC
coiled coil region 925 961 N/A INTRINSIC
low complexity region 971 981 N/A INTRINSIC
coiled coil region 1170 1224 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
low complexity region 1268 1279 N/A INTRINSIC
low complexity region 1524 1529 N/A INTRINSIC
coiled coil region 1652 1671 N/A INTRINSIC
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 T C 11: 94,562,911 Y408C probably damaging Het
Aox4 T C 1: 58,254,318 L943S probably damaging Het
Ap1g1 G A 8: 109,863,326 probably benign Het
Arsb T C 13: 93,794,159 S212P probably damaging Het
Arsi A G 18: 60,916,912 N289S probably damaging Het
Atp6v1h T A 1: 5,095,642 F72I probably damaging Het
Atxn7 T C 14: 14,090,063 I336T probably benign Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Bcl6 A T 16: 23,972,947 M219K possibly damaging Het
Brd3 T C 2: 27,462,448 K157E probably damaging Het
Ccdc171 T G 4: 83,663,655 S674A possibly damaging Het
Cul9 A T 17: 46,525,832 V1089D possibly damaging Het
Dffa C A 4: 149,117,430 A155E probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Efcab12 T A 6: 115,823,490 M191L probably benign Het
Efl1 T C 7: 82,772,499 L1018P probably damaging Het
Fcho1 A G 8: 71,714,956 probably benign Het
Fndc3b T A 3: 27,457,070 T764S probably benign Het
Gm29125 T C 1: 80,384,231 noncoding transcript Het
Gm5108 A G 5: 67,944,610 probably benign Het
Gm9949 T G 18: 62,180,565 probably benign Het
Golgb1 T C 16: 36,875,141 probably benign Het
Gpd2 T C 2: 57,340,204 Y323H probably damaging Het
Grip1 T G 10: 119,931,259 D96E probably benign Het
Hmcn1 T C 1: 150,656,741 I3132V probably benign Het
Hsd17b1 T C 11: 101,080,198 W327R possibly damaging Het
Htra2 G A 6: 83,054,242 P62L probably benign Het
Kdr A T 5: 75,952,417 probably null Het
Kif14 T A 1: 136,527,469 C1626* probably null Het
Kmt2a A T 9: 44,820,246 probably benign Het
Krt15 T C 11: 100,133,433 T321A probably damaging Het
Lactbl1 A T 4: 136,631,045 H109L probably benign Het
Lilra6 T A 7: 3,914,636 H120L probably benign Het
Lpcat2 G A 8: 92,869,737 S134N probably benign Het
Mpp4 T C 1: 59,125,583 D465G probably benign Het
Naip2 A T 13: 100,189,351 D16E probably damaging Het
Nek5 C T 8: 22,083,381 A520T possibly damaging Het
Nfatc2 A G 2: 168,570,707 F132L possibly damaging Het
Nlrp3 C A 11: 59,565,084 T902N probably benign Het
Olfr1097 T C 2: 86,890,602 D191G probably benign Het
Olfr1230 A T 2: 89,296,387 H294Q probably benign Het
Olfr149 A T 9: 39,701,876 W298R probably benign Het
Olfr58 T C 9: 19,783,376 M81T probably damaging Het
Pcdhb16 T C 18: 37,480,089 S701P possibly damaging Het
Phf7 A G 14: 31,248,037 probably null Het
Plpp4 G A 7: 129,316,304 V68M probably damaging Het
Pnma2 A T 14: 66,916,129 M1L possibly damaging Het
Pnmal2 A T 7: 16,945,976 D295V probably damaging Het
Rad21l T C 2: 151,657,462 D270G probably benign Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rasal3 A T 17: 32,396,790 L334Q probably damaging Het
Rfx4 G T 10: 84,863,250 R240L probably damaging Het
Rnf19b T A 4: 129,083,920 C642* probably null Het
Slc28a2 G A 2: 122,458,194 E594K probably benign Het
Spata31 G T 13: 64,917,526 W15L possibly damaging Het
Spink5 T C 18: 44,015,644 S925P probably damaging Het
Svep1 C T 4: 58,084,534 G1865S probably damaging Het
Tg T C 15: 66,773,474 L791P probably damaging Het
Thbs4 A C 13: 92,775,167 V247G probably damaging Het
Tpcn2 A T 7: 145,255,454 F705Y probably damaging Het
Try10 A T 6: 41,356,549 H76L probably damaging Het
Ttn C T 2: 76,939,221 V2695I probably damaging Het
Tut1 C A 19: 8,955,450 T49N probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Xdh G A 17: 73,925,011 R235C probably damaging Het
Yipf4 A G 17: 74,492,475 D70G probably null Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Cfap43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cfap43 APN 19 47830475 missense probably benign 0.08
IGL00325:Cfap43 APN 19 47823188 splice site probably benign
IGL00918:Cfap43 APN 19 47896661 missense probably damaging 1.00
IGL01402:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01404:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01656:Cfap43 APN 19 47751900 missense possibly damaging 0.95
IGL01738:Cfap43 APN 19 47797185 missense probably damaging 0.97
IGL02168:Cfap43 APN 19 47751923 splice site probably benign
IGL02225:Cfap43 APN 19 47812177 missense probably benign 0.00
IGL02308:Cfap43 APN 19 47748024 missense probably benign
IGL02354:Cfap43 APN 19 47897413 nonsense probably null
IGL02361:Cfap43 APN 19 47897413 nonsense probably null
IGL03283:Cfap43 APN 19 47791412 splice site probably benign
3-1:Cfap43 UTSW 19 47751855 missense probably benign 0.02
IGL03046:Cfap43 UTSW 19 47815863 missense probably damaging 1.00
PIT4495001:Cfap43 UTSW 19 47897302 missense probably damaging 1.00
R0270:Cfap43 UTSW 19 47797203 splice site probably benign
R0421:Cfap43 UTSW 19 47835575 missense probably benign 0.00
R0433:Cfap43 UTSW 19 47825771 missense probably benign 0.44
R0576:Cfap43 UTSW 19 47797140 missense probably benign 0.00
R0646:Cfap43 UTSW 19 47763676 missense probably benign 0.25
R0740:Cfap43 UTSW 19 47835804 missense possibly damaging 0.95
R0836:Cfap43 UTSW 19 47815846 missense probably benign 0.02
R0899:Cfap43 UTSW 19 47747994 missense possibly damaging 0.93
R1171:Cfap43 UTSW 19 47835711 missense probably benign 0.03
R1271:Cfap43 UTSW 19 47739744 missense probably benign 0.22
R1271:Cfap43 UTSW 19 47747948 missense probably damaging 0.98
R1371:Cfap43 UTSW 19 47835606 missense possibly damaging 0.95
R1469:Cfap43 UTSW 19 47896875 missense probably damaging 1.00
R1541:Cfap43 UTSW 19 47763852 splice site probably null
R1625:Cfap43 UTSW 19 47751088 missense probably damaging 1.00
R1679:Cfap43 UTSW 19 47773114 missense probably benign 0.00
R1690:Cfap43 UTSW 19 47751066 critical splice donor site probably null
R1820:Cfap43 UTSW 19 47897216 missense probably damaging 0.99
R1891:Cfap43 UTSW 19 47813941 missense probably damaging 0.97
R1956:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R1958:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R2110:Cfap43 UTSW 19 47835758 missense probably damaging 1.00
R2118:Cfap43 UTSW 19 47770438 missense probably damaging 1.00
R2290:Cfap43 UTSW 19 47773135 missense probably damaging 0.99
R3691:Cfap43 UTSW 19 47897073 missense probably benign 0.01
R3765:Cfap43 UTSW 19 47835575 missense probably benign 0.01
R3917:Cfap43 UTSW 19 47897750 missense probably benign 0.00
R3924:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3925:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3947:Cfap43 UTSW 19 47765979 missense probably benign 0.28
R4256:Cfap43 UTSW 19 47782405 missense probably benign 0.06
R4385:Cfap43 UTSW 19 47797129 missense probably benign 0.28
R4395:Cfap43 UTSW 19 47751913 missense probably benign 0.00
R4405:Cfap43 UTSW 19 47739797 missense possibly damaging 0.57
R4541:Cfap43 UTSW 19 47748015 missense probably benign 0.02
R4583:Cfap43 UTSW 19 47837216 missense probably null 0.99
R4690:Cfap43 UTSW 19 47747859 missense probably benign 0.45
R4852:Cfap43 UTSW 19 47897111 missense possibly damaging 0.87
R5192:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5196:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5197:Cfap43 UTSW 19 47897372 missense probably damaging 1.00
R5205:Cfap43 UTSW 19 47897548 missense possibly damaging 0.76
R5425:Cfap43 UTSW 19 47896932 missense possibly damaging 0.94
R5516:Cfap43 UTSW 19 47738209 intron probably null
R5644:Cfap43 UTSW 19 47795675 missense possibly damaging 0.66
R5844:Cfap43 UTSW 19 47795696 missense probably benign
R5901:Cfap43 UTSW 19 47897099 missense probably damaging 0.97
R5910:Cfap43 UTSW 19 47780271 missense possibly damaging 0.63
R5920:Cfap43 UTSW 19 47760896 missense possibly damaging 0.88
R5963:Cfap43 UTSW 19 47745574 missense probably benign 0.42
R6817:Cfap43 UTSW 19 47756085 missense possibly damaging 0.88
R6974:Cfap43 UTSW 19 47785278 critical splice donor site probably null
R7219:Cfap43 UTSW 19 47791473 missense probably benign 0.02
R7270:Cfap43 UTSW 19 47739785 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AATCACTGGACTTGTGGGTAAG -3'
(R):5'- TGGAGAACTTCGCCATGATTC -3'

Sequencing Primer
(F):5'- CATATGCGCATAAAATCTATGAAGGG -3'
(R):5'- AGAACTTCGCCATGATTCTTTGTG -3'
Posted On2016-07-06