Incidental Mutation 'R3917:Cfap43'
ID307391
Institutional Source Beutler Lab
Gene Symbol Cfap43
Ensembl Gene ENSMUSG00000044948
Gene Namecilia and flagella associated protein 43
Synonyms4930463G05Rik, D19Ertd652e, 4632415N18Rik, 4930428C11Rik, Wdr96
MMRRC Submission 040914-MU
Accession Numbers

Genbank: NM_027559

Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R3917 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47737561-47919299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47897750 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 142 (D142G)
Ref Sequence ENSEMBL: ENSMUSP00000093697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095998]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026048
Predicted Effect probably benign
Transcript: ENSMUST00000095998
AA Change: D142G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093697
Gene: ENSMUSG00000044948
AA Change: D142G

DomainStartEndE-ValueType
SCOP:d1eq1a_ 27 82 3e-3 SMART
low complexity region 115 135 N/A INTRINSIC
Mab-21 194 528 4.37e-84 SMART
Meta Mutation Damage Score 0.1636 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A G 5: 121,599,214 V498A probably damaging Het
Adam19 A G 11: 46,060,935 E37G probably benign Het
Apol11b A G 15: 77,635,304 I192T probably benign Het
Appl1 A T 14: 26,928,604 F537Y probably damaging Het
Atad5 A C 11: 80,103,294 K785N probably null Het
Atp1b2 A G 11: 69,603,075 V93A probably damaging Het
Bcam T C 7: 19,765,450 Y216C probably damaging Het
Brca2 A G 5: 150,540,827 E1352G probably damaging Het
C030005K15Rik A C 10: 97,725,591 S93A unknown Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Ccdc88c A G 12: 100,941,107 probably null Het
Ccdc89 A G 7: 90,426,825 D81G probably damaging Het
Ccnt1 A G 15: 98,544,059 S443P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc42bpa T C 1: 180,106,154 probably null Het
Cdk11b T C 4: 155,626,801 S47P probably damaging Het
Cntnap4 C G 8: 112,875,533 P1190A probably benign Het
Colgalt2 T A 1: 152,508,611 Y567* probably null Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock7 T C 4: 99,016,685 Y651C probably damaging Het
Fzd3 A T 14: 65,235,930 F130I probably damaging Het
Gabarapl2 T A 8: 111,952,396 F115L probably benign Het
Gm1043 G A 5: 37,192,941 probably benign Het
Gm12185 A G 11: 48,915,933 F144L probably benign Het
Gm14124 T A 2: 150,266,119 probably benign Het
Gm21961 A T 15: 65,014,884 D7E unknown Het
Gtf3a A G 5: 146,955,434 K332E probably benign Het
Haao A G 17: 83,838,799 probably null Het
Habp2 T A 19: 56,311,179 C170S probably damaging Het
Heatr3 T G 8: 88,150,371 probably null Het
Herc1 T G 9: 66,434,466 C1846G possibly damaging Het
Hivep3 T C 4: 120,099,427 S1647P probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspg2 A G 4: 137,559,314 E3648G probably damaging Het
Jaml T C 9: 45,101,151 probably benign Het
Jund C T 8: 70,699,023 probably benign Het
Klra14-ps T C 6: 130,157,632 noncoding transcript Het
Krt88 G A 15: 101,452,928 probably null Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lyzl4 T A 9: 121,583,035 D105V probably damaging Het
Mst1 A G 9: 108,084,295 I575V probably benign Het
Myd88 T C 9: 119,341,398 probably benign Het
Myo1d A T 11: 80,666,578 V512E probably damaging Het
Ndufv1 A G 19: 4,010,002 Y33H probably damaging Het
Nwd1 T A 8: 72,667,811 C608* probably null Het
Olfr118 T A 17: 37,672,793 F257I probably damaging Het
Olfr884 A T 9: 38,047,545 I108F probably damaging Het
Patj A T 4: 98,592,008 K1317* probably null Het
Pld5 A G 1: 175,963,938 S501P probably benign Het
Pnpo A G 11: 96,939,757 V146A probably damaging Het
Ppdpf A G 2: 181,187,728 Y16C probably benign Het
Ppp1r27 A G 11: 120,550,959 V32A possibly damaging Het
Rbm28 T C 6: 29,154,789 D294G probably benign Het
Sdk1 T A 5: 142,051,244 D817E probably damaging Het
Shank3 A G 15: 89,503,384 D252G possibly damaging Het
Slc29a1 A T 17: 45,588,973 probably null Het
Slc35a5 G C 16: 45,158,158 probably benign Het
Slc6a5 T C 7: 49,911,869 S50P probably damaging Het
Slfn8 A T 11: 83,016,993 Y241* probably null Het
Slu7 G T 11: 43,440,684 probably null Het
Smad2 T A 18: 76,287,937 D82E probably benign Het
Spx A C 6: 142,414,031 E33A probably damaging Het
Tdp1 A G 12: 99,894,717 Y205C probably damaging Het
Tekt1 A G 11: 72,345,748 I296T possibly damaging Het
Tgm1 G A 14: 55,712,757 probably benign Het
Tnks A G 8: 34,853,361 S719P probably damaging Het
Trip6 A G 5: 137,313,679 C47R probably benign Het
Trpv3 A G 11: 73,283,734 D309G possibly damaging Het
Tti2 A G 8: 31,153,519 K221E possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r57 A T 7: 5,220,631 N52Y probably damaging Het
Vmn2r94 A G 17: 18,244,358 F557L probably benign Het
Zbed5 T C 5: 129,902,277 Y356H possibly damaging Het
Zic4 C A 9: 91,384,341 probably benign Het
Other mutations in Cfap43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cfap43 APN 19 47830475 missense probably benign 0.08
IGL00325:Cfap43 APN 19 47823188 splice site probably benign
IGL00918:Cfap43 APN 19 47896661 missense probably damaging 1.00
IGL01402:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01404:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01656:Cfap43 APN 19 47751900 missense possibly damaging 0.95
IGL01738:Cfap43 APN 19 47797185 missense probably damaging 0.97
IGL02168:Cfap43 APN 19 47751923 splice site probably benign
IGL02225:Cfap43 APN 19 47812177 missense probably benign 0.00
IGL02308:Cfap43 APN 19 47748024 missense probably benign
IGL02354:Cfap43 APN 19 47897413 nonsense probably null
IGL02361:Cfap43 APN 19 47897413 nonsense probably null
IGL03283:Cfap43 APN 19 47791412 splice site probably benign
3-1:Cfap43 UTSW 19 47751855 missense probably benign 0.02
IGL03046:Cfap43 UTSW 19 47815863 missense probably damaging 1.00
PIT4495001:Cfap43 UTSW 19 47897302 missense probably damaging 1.00
R0270:Cfap43 UTSW 19 47797203 splice site probably benign
R0421:Cfap43 UTSW 19 47835575 missense probably benign 0.00
R0433:Cfap43 UTSW 19 47825771 missense probably benign 0.44
R0576:Cfap43 UTSW 19 47797140 missense probably benign 0.00
R0646:Cfap43 UTSW 19 47763676 missense probably benign 0.25
R0740:Cfap43 UTSW 19 47835804 missense possibly damaging 0.95
R0836:Cfap43 UTSW 19 47815846 missense probably benign 0.02
R0899:Cfap43 UTSW 19 47747994 missense possibly damaging 0.93
R1171:Cfap43 UTSW 19 47835711 missense probably benign 0.03
R1271:Cfap43 UTSW 19 47739744 missense probably benign 0.22
R1271:Cfap43 UTSW 19 47747948 missense probably damaging 0.98
R1371:Cfap43 UTSW 19 47835606 missense possibly damaging 0.95
R1469:Cfap43 UTSW 19 47896875 missense probably damaging 1.00
R1541:Cfap43 UTSW 19 47763852 splice site probably null
R1625:Cfap43 UTSW 19 47751088 missense probably damaging 1.00
R1679:Cfap43 UTSW 19 47773114 missense probably benign 0.00
R1690:Cfap43 UTSW 19 47751066 critical splice donor site probably null
R1820:Cfap43 UTSW 19 47897216 missense probably damaging 0.99
R1891:Cfap43 UTSW 19 47813941 missense probably damaging 0.97
R1956:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R1958:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R2110:Cfap43 UTSW 19 47835758 missense probably damaging 1.00
R2118:Cfap43 UTSW 19 47770438 missense probably damaging 1.00
R2290:Cfap43 UTSW 19 47773135 missense probably damaging 0.99
R3691:Cfap43 UTSW 19 47897073 missense probably benign 0.01
R3765:Cfap43 UTSW 19 47835575 missense probably benign 0.01
R3924:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3925:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3947:Cfap43 UTSW 19 47765979 missense probably benign 0.28
R4256:Cfap43 UTSW 19 47782405 missense probably benign 0.06
R4385:Cfap43 UTSW 19 47797129 missense probably benign 0.28
R4395:Cfap43 UTSW 19 47751913 missense probably benign 0.00
R4405:Cfap43 UTSW 19 47739797 missense possibly damaging 0.57
R4541:Cfap43 UTSW 19 47748015 missense probably benign 0.02
R4583:Cfap43 UTSW 19 47837216 missense probably null 0.99
R4690:Cfap43 UTSW 19 47747859 missense probably benign 0.45
R4852:Cfap43 UTSW 19 47897111 missense possibly damaging 0.87
R5185:Cfap43 UTSW 19 47780394 missense probably benign 0.00
R5192:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5196:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5197:Cfap43 UTSW 19 47897372 missense probably damaging 1.00
R5205:Cfap43 UTSW 19 47897548 missense possibly damaging 0.76
R5425:Cfap43 UTSW 19 47896932 missense possibly damaging 0.94
R5516:Cfap43 UTSW 19 47738209 intron probably null
R5644:Cfap43 UTSW 19 47795675 missense possibly damaging 0.66
R5844:Cfap43 UTSW 19 47795696 missense probably benign
R5901:Cfap43 UTSW 19 47897099 missense probably damaging 0.97
R5910:Cfap43 UTSW 19 47780271 missense possibly damaging 0.63
R5920:Cfap43 UTSW 19 47760896 missense possibly damaging 0.88
R5963:Cfap43 UTSW 19 47745574 missense probably benign 0.42
R6817:Cfap43 UTSW 19 47756085 missense possibly damaging 0.88
R6974:Cfap43 UTSW 19 47785278 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCATACATGCTGCCCACG -3'
(R):5'- CATACGCAAGATGCAGGAGC -3'

Sequencing Primer
(F):5'- GCCGATGAAGTCCTCCAATTC -3'
(R):5'- AGGTGTCACGTCTGGAGGC -3'
Posted On2015-04-17