Incidental Mutation 'R3925:Cfap43'
ID308258
Institutional Source Beutler Lab
Gene Symbol Cfap43
Ensembl Gene ENSMUSG00000044948
Gene Namecilia and flagella associated protein 43
Synonyms4930463G05Rik, D19Ertd652e, 4632415N18Rik, 4930428C11Rik, Wdr96
MMRRC Submission 040916-MU
Accession Numbers

Genbank: NM_027559

Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47737561-47919299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47797116 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 445 (K445R)
Ref Sequence ENSEMBL: ENSMUSP00000125007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160247]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026048
Predicted Effect probably benign
Transcript: ENSMUST00000160247
AA Change: K445R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948
AA Change: K445R

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Blast:WD40 70 111 6e-7 BLAST
Blast:WD40 115 156 1e-5 BLAST
Blast:WD40 162 197 8e-10 BLAST
WD40 349 388 1.07e0 SMART
Blast:WD40 392 432 3e-13 BLAST
WD40 435 473 3.96e1 SMART
WD40 479 518 3.82e1 SMART
Blast:WD40 638 683 8e-17 BLAST
Blast:WD40 689 728 1e-17 BLAST
low complexity region 766 781 N/A INTRINSIC
coiled coil region 855 886 N/A INTRINSIC
coiled coil region 925 961 N/A INTRINSIC
low complexity region 971 981 N/A INTRINSIC
coiled coil region 1170 1224 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
low complexity region 1268 1279 N/A INTRINSIC
low complexity region 1524 1529 N/A INTRINSIC
coiled coil region 1652 1671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160970
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Cfap43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cfap43 APN 19 47830475 missense probably benign 0.08
IGL00325:Cfap43 APN 19 47823188 splice site probably benign
IGL00918:Cfap43 APN 19 47896661 missense probably damaging 1.00
IGL01402:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01404:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01656:Cfap43 APN 19 47751900 missense possibly damaging 0.95
IGL01738:Cfap43 APN 19 47797185 missense probably damaging 0.97
IGL02168:Cfap43 APN 19 47751923 splice site probably benign
IGL02225:Cfap43 APN 19 47812177 missense probably benign 0.00
IGL02308:Cfap43 APN 19 47748024 missense probably benign
IGL02354:Cfap43 APN 19 47897413 nonsense probably null
IGL02361:Cfap43 APN 19 47897413 nonsense probably null
IGL03283:Cfap43 APN 19 47791412 splice site probably benign
3-1:Cfap43 UTSW 19 47751855 missense probably benign 0.02
IGL03046:Cfap43 UTSW 19 47815863 missense probably damaging 1.00
PIT4495001:Cfap43 UTSW 19 47897302 missense probably damaging 1.00
R0270:Cfap43 UTSW 19 47797203 splice site probably benign
R0421:Cfap43 UTSW 19 47835575 missense probably benign 0.00
R0433:Cfap43 UTSW 19 47825771 missense probably benign 0.44
R0576:Cfap43 UTSW 19 47797140 missense probably benign 0.00
R0646:Cfap43 UTSW 19 47763676 missense probably benign 0.25
R0740:Cfap43 UTSW 19 47835804 missense possibly damaging 0.95
R0836:Cfap43 UTSW 19 47815846 missense probably benign 0.02
R0899:Cfap43 UTSW 19 47747994 missense possibly damaging 0.93
R1171:Cfap43 UTSW 19 47835711 missense probably benign 0.03
R1271:Cfap43 UTSW 19 47739744 missense probably benign 0.22
R1271:Cfap43 UTSW 19 47747948 missense probably damaging 0.98
R1371:Cfap43 UTSW 19 47835606 missense possibly damaging 0.95
R1469:Cfap43 UTSW 19 47896875 missense probably damaging 1.00
R1541:Cfap43 UTSW 19 47763852 splice site probably null
R1625:Cfap43 UTSW 19 47751088 missense probably damaging 1.00
R1679:Cfap43 UTSW 19 47773114 missense probably benign 0.00
R1690:Cfap43 UTSW 19 47751066 critical splice donor site probably null
R1820:Cfap43 UTSW 19 47897216 missense probably damaging 0.99
R1891:Cfap43 UTSW 19 47813941 missense probably damaging 0.97
R1956:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R1958:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R2110:Cfap43 UTSW 19 47835758 missense probably damaging 1.00
R2118:Cfap43 UTSW 19 47770438 missense probably damaging 1.00
R2290:Cfap43 UTSW 19 47773135 missense probably damaging 0.99
R3691:Cfap43 UTSW 19 47897073 missense probably benign 0.01
R3765:Cfap43 UTSW 19 47835575 missense probably benign 0.01
R3917:Cfap43 UTSW 19 47897750 missense probably benign 0.00
R3924:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3947:Cfap43 UTSW 19 47765979 missense probably benign 0.28
R4256:Cfap43 UTSW 19 47782405 missense probably benign 0.06
R4385:Cfap43 UTSW 19 47797129 missense probably benign 0.28
R4395:Cfap43 UTSW 19 47751913 missense probably benign 0.00
R4405:Cfap43 UTSW 19 47739797 missense possibly damaging 0.57
R4541:Cfap43 UTSW 19 47748015 missense probably benign 0.02
R4583:Cfap43 UTSW 19 47837216 missense probably null 0.99
R4690:Cfap43 UTSW 19 47747859 missense probably benign 0.45
R4852:Cfap43 UTSW 19 47897111 missense possibly damaging 0.87
R5185:Cfap43 UTSW 19 47780394 missense probably benign 0.00
R5192:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5196:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5197:Cfap43 UTSW 19 47897372 missense probably damaging 1.00
R5205:Cfap43 UTSW 19 47897548 missense possibly damaging 0.76
R5425:Cfap43 UTSW 19 47896932 missense possibly damaging 0.94
R5516:Cfap43 UTSW 19 47738209 intron probably null
R5644:Cfap43 UTSW 19 47795675 missense possibly damaging 0.66
R5844:Cfap43 UTSW 19 47795696 missense probably benign
R5901:Cfap43 UTSW 19 47897099 missense probably damaging 0.97
R5910:Cfap43 UTSW 19 47780271 missense possibly damaging 0.63
R5920:Cfap43 UTSW 19 47760896 missense possibly damaging 0.88
R5963:Cfap43 UTSW 19 47745574 missense probably benign 0.42
R6817:Cfap43 UTSW 19 47756085 missense possibly damaging 0.88
R6974:Cfap43 UTSW 19 47785278 critical splice donor site probably null
R7219:Cfap43 UTSW 19 47791473 missense probably benign 0.02
R7270:Cfap43 UTSW 19 47739785 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGTGATGTGAGCTTGGCAC -3'
(R):5'- TCTGTGCCTGTAACCCTAGC -3'

Sequencing Primer
(F):5'- TGAGCTTGGCACCGTGG -3'
(R):5'- TGCCTGTAACCCTAGCACAATTAATC -3'
Posted On2015-04-17