Incidental Mutation 'R0455:Serpinb7'
ID39939
Institutional Source Beutler Lab
Gene Symbol Serpinb7
Ensembl Gene ENSMUSG00000067001
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 7
Synonymsmegsin, 4631416M05Rik, ovalbumin
MMRRC Submission 038655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0455 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location107399655-107452689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107451610 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 249 (I249T)
Ref Sequence ENSEMBL: ENSMUSP00000083896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086690
AA Change: I249T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083896
Gene: ENSMUSG00000067001
AA Change: I249T

DomainStartEndE-ValueType
SERPIN 13 380 2.7e-121 SMART
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins which function as protease inhibitors. Expression of this gene is upregulated in IgA nephropathy and mutations have been found to cause palmoplantar keratoderma, Nagashima type. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,230,983 G342D possibly damaging Het
Acvr2b C T 9: 119,432,609 R399W probably damaging Het
AI464131 G A 4: 41,499,538 R31* probably null Het
Atf6 A G 1: 170,834,923 V256A probably benign Het
Atp2b4 A T 1: 133,728,716 I732N probably damaging Het
C1qtnf9 A C 14: 60,772,371 Q25H probably damaging Het
Ccdc6 T A 10: 70,142,571 probably benign Het
Cds2 T C 2: 132,285,967 probably null Het
Chdh A G 14: 30,034,646 Y343C probably damaging Het
Col5a2 T C 1: 45,382,102 probably benign Het
Cts3 G A 13: 61,568,210 probably benign Het
Cyfip1 T A 7: 55,892,054 D362E probably benign Het
Dsg1b T A 18: 20,396,025 S273T probably benign Het
Dysf A T 6: 84,140,667 H1274L probably benign Het
Eva1c T C 16: 90,876,098 S187P probably benign Het
Fam126b T C 1: 58,534,479 probably benign Het
Fam13b G A 18: 34,445,528 probably benign Het
Fam172a T A 13: 77,834,713 probably benign Het
Fbn2 C T 18: 58,035,336 G2310S probably damaging Het
Fcna T C 2: 25,625,508 Y183C probably damaging Het
Fnta T C 8: 26,001,028 T263A probably benign Het
Gm94 T C 18: 43,781,244 D83G possibly damaging Het
Gnal C T 18: 67,135,649 probably benign Het
Grb7 T G 11: 98,452,188 S244A probably benign Het
Grm3 T C 5: 9,512,477 T458A probably benign Het
Hdac2 C T 10: 36,991,836 R193C probably damaging Het
Ighmbp2 T C 19: 3,265,072 R783G probably benign Het
Inpp5j G T 11: 3,503,122 L43I possibly damaging Het
Itga11 A T 9: 62,696,961 T44S probably damaging Het
Itsn1 C T 16: 91,868,148 probably benign Het
Kdm6b G T 11: 69,406,996 C233* probably null Het
Lamb3 T C 1: 193,343,392 L1130P probably damaging Het
Lrch3 T C 16: 32,986,880 F508L probably damaging Het
Lrrd1 T A 5: 3,866,425 V814E probably benign Het
Megf10 C T 18: 57,252,982 P356S probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nus1 T A 10: 52,430,094 V42E probably damaging Het
Olfr435 A C 6: 43,202,072 M143L probably benign Het
Olfr739 A G 14: 50,424,902 I128V possibly damaging Het
Padi3 T C 4: 140,795,713 N306S probably damaging Het
Pex13 T C 11: 23,655,949 S94G probably benign Het
Ppm1h G T 10: 122,802,324 Q166H probably benign Het
Ptafr A T 4: 132,580,085 Y262F probably benign Het
Rabgap1 T A 2: 37,487,120 D321E probably damaging Het
Samsn1 C T 16: 75,945,225 noncoding transcript Het
Scarb1 T C 5: 125,289,681 N63D probably damaging Het
Srpr A G 9: 35,214,981 K490R probably benign Het
Sycn A G 7: 28,540,973 N22D probably benign Het
Tarbp1 C T 8: 126,440,873 A1067T probably benign Het
Tex14 A G 11: 87,514,305 D681G possibly damaging Het
Usp34 C T 11: 23,446,741 probably benign Het
Vmn2r107 T C 17: 20,374,823 probably benign Het
Vwde A T 6: 13,187,529 M653K probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Other mutations in Serpinb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Serpinb7 APN 1 107428246 utr 5 prime probably benign
IGL01325:Serpinb7 APN 1 107435380 missense probably damaging 0.98
IGL01595:Serpinb7 APN 1 107428322 missense probably damaging 0.97
IGL01925:Serpinb7 APN 1 107451669 missense probably benign 0.01
IGL02008:Serpinb7 APN 1 107448129 missense possibly damaging 0.51
IGL02206:Serpinb7 APN 1 107435372 missense possibly damaging 0.88
IGL02870:Serpinb7 APN 1 107450287 missense probably damaging 1.00
IGL03010:Serpinb7 APN 1 107452011 utr 3 prime probably benign
R0492:Serpinb7 UTSW 1 107452007 makesense probably null
R0664:Serpinb7 UTSW 1 107428307 missense probably damaging 0.98
R1495:Serpinb7 UTSW 1 107451660 nonsense probably null
R1540:Serpinb7 UTSW 1 107428268 missense possibly damaging 0.72
R1789:Serpinb7 UTSW 1 107450273 missense possibly damaging 0.58
R1850:Serpinb7 UTSW 1 107428295 missense probably damaging 1.00
R2962:Serpinb7 UTSW 1 107451726 missense probably benign 0.00
R3151:Serpinb7 UTSW 1 107435351 nonsense probably null
R3439:Serpinb7 UTSW 1 107428351 missense probably damaging 1.00
R4064:Serpinb7 UTSW 1 107446036 missense probably benign 0.09
R4590:Serpinb7 UTSW 1 107451833 missense probably damaging 1.00
R5260:Serpinb7 UTSW 1 107434749 missense possibly damaging 0.74
R5637:Serpinb7 UTSW 1 107428307 missense probably damaging 1.00
R5914:Serpinb7 UTSW 1 107451850 missense probably damaging 1.00
R5992:Serpinb7 UTSW 1 107445996 missense probably damaging 1.00
R6013:Serpinb7 UTSW 1 107450189 missense probably benign
R6317:Serpinb7 UTSW 1 107451706 missense probably damaging 1.00
R6494:Serpinb7 UTSW 1 107435346 nonsense probably null
R7181:Serpinb7 UTSW 1 107450322 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCCAATATGCACAGGGATTGGAC -3'
(R):5'- TGGACTCAGGAAGCTGCTTTTCAAC -3'

Sequencing Primer
(F):5'- TCATGAGTTAAACAAGCAACCTG -3'
(R):5'- TTTGATACGTAGAGACGACCTCC -3'
Posted On2013-05-23