Incidental Mutation 'R0664:Serpinb7'
ID61937
Institutional Source Beutler Lab
Gene Symbol Serpinb7
Ensembl Gene ENSMUSG00000067001
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 7
Synonymsmegsin, 4631416M05Rik, ovalbumin
MMRRC Submission 038849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0664 (G1)
Quality Score92
Status Validated
Chromosome1
Chromosomal Location107399655-107452689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107428307 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 20 (D20G)
Ref Sequence ENSEMBL: ENSMUSP00000119217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086690] [ENSMUST00000154538]
Predicted Effect probably damaging
Transcript: ENSMUST00000086690
AA Change: D20G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083896
Gene: ENSMUSG00000067001
AA Change: D20G

DomainStartEndE-ValueType
SERPIN 13 380 2.7e-121 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154538
AA Change: D20G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119217
Gene: ENSMUSG00000067001
AA Change: D20G

DomainStartEndE-ValueType
Pfam:Serpin 6 97 4.9e-20 PFAM
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins which function as protease inhibitors. Expression of this gene is upregulated in IgA nephropathy and mutations have been found to cause palmoplantar keratoderma, Nagashima type. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
A530064D06Rik T C 17: 48,166,591 I53V probably benign Het
Agmo A T 12: 37,252,572 H136L probably damaging Het
B020004C17Rik G A 14: 57,016,768 R116H possibly damaging Het
Btbd11 G A 10: 85,388,370 A348T possibly damaging Het
Cacna1b A G 2: 24,654,446 S1243P probably damaging Het
Champ1 G A 8: 13,879,485 V548M probably damaging Het
Dnah7b A T 1: 46,324,842 M3541L probably damaging Het
Emc9 A G 14: 55,581,908 L138P possibly damaging Het
Epcam T A 17: 87,639,970 Y51N possibly damaging Het
Gpr55 A T 1: 85,941,017 S281T probably benign Het
Grid2ip T A 5: 143,363,977 probably null Het
Hgfac G T 5: 35,048,178 V601F probably benign Het
Hlcs A G 16: 94,231,311 W545R probably damaging Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Ipo8 A T 6: 148,800,213 L466I probably benign Het
Jcad A G 18: 4,676,063 D1275G probably damaging Het
Mdn1 G T 4: 32,768,011 E5315* probably null Het
Nfam1 T C 15: 83,014,938 T176A probably damaging Het
Nsd3 T C 8: 25,714,240 F432S probably damaging Het
Olfr1183 C T 2: 88,462,171 P296L probably damaging Het
Prmt5 G T 14: 54,507,856 T618K probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Slco1a4 T C 6: 141,812,741 I515V probably benign Het
Stk26 T A X: 50,887,926 Y283* probably null Het
Tanc1 A T 2: 59,843,884 K1778* probably null Het
Thada A G 17: 84,336,829 L1288P probably damaging Het
Ttbk2 C A 2: 120,748,821 V607F probably damaging Het
Other mutations in Serpinb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Serpinb7 APN 1 107428246 utr 5 prime probably benign
IGL01325:Serpinb7 APN 1 107435380 missense probably damaging 0.98
IGL01595:Serpinb7 APN 1 107428322 missense probably damaging 0.97
IGL01925:Serpinb7 APN 1 107451669 missense probably benign 0.01
IGL02008:Serpinb7 APN 1 107448129 missense possibly damaging 0.51
IGL02206:Serpinb7 APN 1 107435372 missense possibly damaging 0.88
IGL02870:Serpinb7 APN 1 107450287 missense probably damaging 1.00
IGL03010:Serpinb7 APN 1 107452011 utr 3 prime probably benign
R0455:Serpinb7 UTSW 1 107451610 missense possibly damaging 0.91
R0492:Serpinb7 UTSW 1 107452007 makesense probably null
R1495:Serpinb7 UTSW 1 107451660 nonsense probably null
R1540:Serpinb7 UTSW 1 107428268 missense possibly damaging 0.72
R1789:Serpinb7 UTSW 1 107450273 missense possibly damaging 0.58
R1850:Serpinb7 UTSW 1 107428295 missense probably damaging 1.00
R2962:Serpinb7 UTSW 1 107451726 missense probably benign 0.00
R3151:Serpinb7 UTSW 1 107435351 nonsense probably null
R3439:Serpinb7 UTSW 1 107428351 missense probably damaging 1.00
R4064:Serpinb7 UTSW 1 107446036 missense probably benign 0.09
R4590:Serpinb7 UTSW 1 107451833 missense probably damaging 1.00
R5260:Serpinb7 UTSW 1 107434749 missense possibly damaging 0.74
R5637:Serpinb7 UTSW 1 107428307 missense probably damaging 1.00
R5914:Serpinb7 UTSW 1 107451850 missense probably damaging 1.00
R5992:Serpinb7 UTSW 1 107445996 missense probably damaging 1.00
R6013:Serpinb7 UTSW 1 107450189 missense probably benign
R6317:Serpinb7 UTSW 1 107451706 missense probably damaging 1.00
R6494:Serpinb7 UTSW 1 107435346 nonsense probably null
R7181:Serpinb7 UTSW 1 107450322 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCAAGCTGCTTGATGATTGCAC -3'
(R):5'- GCTGTGGTTGCCATCAAAGCTAAAG -3'

Sequencing Primer
(F):5'- CTGCTTGATGATTGCACACAAAG -3'
(R):5'- GTGAAGTCCAGTGCTTATCATGAAAC -3'
Posted On2013-07-30