Incidental Mutation 'R5208:Gulp1'
ID402117
Institutional Source Beutler Lab
Gene Symbol Gulp1
Ensembl Gene ENSMUSG00000056870
Gene NameGULP, engulfment adaptor PTB domain containing 1
Synonyms3110030A04Rik, GULP, CED-6, Ced6, 5730529O06Rik
MMRRC Submission 042783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5208 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location44551511-44796838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44781039 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 235 (H235Q)
Ref Sequence ENSEMBL: ENSMUSP00000124756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074525] [ENSMUST00000159555] [ENSMUST00000160854] [ENSMUST00000162600]
Predicted Effect probably benign
Transcript: ENSMUST00000074525
AA Change: H227Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074115
Gene: ENSMUSG00000056870
AA Change: H227Q

DomainStartEndE-ValueType
PTB 22 158 1.11e-38 SMART
coiled coil region 159 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159555
Predicted Effect probably benign
Transcript: ENSMUST00000160854
AA Change: H227Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125506
Gene: ENSMUSG00000056870
AA Change: H227Q

DomainStartEndE-ValueType
PTB 22 158 1.11e-38 SMART
coiled coil region 159 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161793
Predicted Effect probably benign
Transcript: ENSMUST00000162600
AA Change: H235Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124756
Gene: ENSMUSG00000056870
AA Change: H235Q

DomainStartEndE-ValueType
PTB 22 158 1.11e-38 SMART
coiled coil region 178 210 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adapter protein necessary for the engulfment of apoptotic cells by phagocytes. Several transcript variants, some protein coding and some thought not to be protein coding, have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C A 7: 140,298,036 A977D probably benign Het
Aadacl4 A T 4: 144,617,828 N58I probably benign Het
Adgra3 T C 5: 50,011,515 D163G probably damaging Het
Alcam C A 16: 52,295,048 E236* probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Aplf G T 6: 87,642,026 probably null Het
Arl4a A T 12: 40,036,745 M1K probably null Het
Asic4 A G 1: 75,451,226 D132G probably damaging Het
Bbs12 T C 3: 37,320,273 I290T probably benign Het
BC024139 A G 15: 76,124,665 S290P probably benign Het
Bmp6 G A 13: 38,469,697 A247T probably benign Het
Cadps A G 14: 12,457,711 S1057P possibly damaging Het
Caprin1 A C 2: 103,769,433 probably null Het
Cdc42bpg G A 19: 6,321,720 R1343K probably benign Het
Cdk18 A T 1: 132,117,480 probably null Het
Cenpf A T 1: 189,671,046 probably null Het
Cfhr1 A T 1: 139,556,330 probably null Het
Chn2 A T 6: 54,295,801 I201F probably damaging Het
Chrdl2 A G 7: 100,023,922 D175G probably damaging Het
Disp2 G T 2: 118,791,805 R1006L probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah3 C G 7: 120,032,638 D1365H probably damaging Het
Efcab8 T A 2: 153,802,423 Y372* probably null Het
Eftud2 G A 11: 102,841,185 P768S probably damaging Het
Ehmt1 A C 2: 24,801,533 S1170A probably benign Het
Gdpd4 A C 7: 98,014,911 K572Q probably benign Het
Gm7356 T C 17: 14,001,194 E191G probably damaging Het
Gm8674 A T 13: 49,901,921 noncoding transcript Het
Hormad1 T C 3: 95,578,107 V202A possibly damaging Het
Inpp5b G A 4: 124,751,317 D179N possibly damaging Het
Kcnk4 T A 19: 6,927,701 Y194F possibly damaging Het
Lars A C 18: 42,217,557 S896A probably benign Het
Lonp1 A G 17: 56,617,793 V538A probably damaging Het
Map3k14 A T 11: 103,239,146 L315Q probably damaging Het
Met T A 6: 17,526,423 Y500* probably null Het
Mga T G 2: 119,947,981 I2093M possibly damaging Het
Mpl T G 4: 118,455,881 I152L probably benign Het
Mthfsd G A 8: 121,108,319 probably benign Het
Mup4 A G 4: 59,958,119 F150L probably damaging Het
Mybph T A 1: 134,193,535 V11D probably benign Het
Olfr1278 A T 2: 111,292,601 E111V probably damaging Het
Olfr668 A G 7: 104,925,726 F13L probably benign Het
Olfr988 T A 2: 85,353,798 I43F probably benign Het
Pde4a T C 9: 21,203,558 probably null Het
Pex2 C T 3: 5,561,368 R127H probably benign Het
Pgap3 A G 11: 98,398,048 W94R probably damaging Het
Prl4a1 T C 13: 28,018,484 V14A probably benign Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Ptprn2 A G 12: 116,858,928 Y209C probably damaging Het
Sema4c T A 1: 36,550,326 D573V probably damaging Het
Setx A T 2: 29,166,367 I2192F possibly damaging Het
Sp4 A G 12: 118,299,546 L255P probably damaging Het
Spaca7 A G 8: 12,586,456 Y94C probably damaging Het
Stt3a T G 9: 36,746,595 I390L possibly damaging Het
Tars2 A G 3: 95,747,593 W128R probably damaging Het
Tll1 G A 8: 64,051,493 T623M probably damaging Het
Tmem129 A T 5: 33,655,506 V166E probably damaging Het
Tmem200a T A 10: 25,994,153 I73F probably benign Het
Tnks1bp1 T C 2: 85,070,632 M1561T probably damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Zfat A T 15: 68,180,721 I401N probably damaging Het
Zfp142 A T 1: 74,570,868 V1153E probably benign Het
Zwilch T C 9: 64,152,923 I354V probably benign Het
Other mutations in Gulp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Gulp1 APN 1 44744548 splice site probably benign
IGL02439:Gulp1 APN 1 44781004 missense probably damaging 0.96
IGL03410:Gulp1 APN 1 44708617 missense probably damaging 0.97
guzzle UTSW 1 44708669 nonsense probably null
R1746:Gulp1 UTSW 1 44754353 missense possibly damaging 0.81
R1990:Gulp1 UTSW 1 44766114 missense possibly damaging 0.92
R4166:Gulp1 UTSW 1 44708669 nonsense probably null
R4895:Gulp1 UTSW 1 44788597 missense probably benign
R5244:Gulp1 UTSW 1 44788453 missense probably damaging 1.00
R5533:Gulp1 UTSW 1 44773281 missense probably damaging 1.00
R5911:Gulp1 UTSW 1 44754374 missense possibly damaging 0.55
R6164:Gulp1 UTSW 1 44754351 missense probably damaging 0.98
R6503:Gulp1 UTSW 1 44773380 missense probably damaging 1.00
R7026:Gulp1 UTSW 1 44781085 missense possibly damaging 0.65
R7091:Gulp1 UTSW 1 44766134 missense probably damaging 0.99
R7207:Gulp1 UTSW 1 44766132 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CCCATCCTCAAATGTGTTCACG -3'
(R):5'- GGTTCAATTTGCAAATAGGGATGTG -3'

Sequencing Primer
(F):5'- TGGAAAGTTATATGACTACCCCCAGG -3'
(R):5'- GCAAATAGGGATGTGCTTAGTATTC -3'
Posted On2016-07-22