Incidental Mutation 'R0025:Mbd4'
ID40770
Institutional Source Beutler Lab
Gene Symbol Mbd4
Ensembl Gene ENSMUSG00000030322
Gene Namemethyl-CpG binding domain protein 4
SynonymsMed1
MMRRC Submission 038320-MU
Accession Numbers

Ncbi RefSeq: NM_010774.2; MGI:1333850

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0025 (G1)
Quality Score168
Status Validated
Chromosome6
Chromosomal Location115840697-115853371 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 115844568 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032469] [ENSMUST00000122816] [ENSMUST00000147282] [ENSMUST00000203643]
Predicted Effect probably null
Transcript: ENSMUST00000032469
SMART Domains Protein: ENSMUSP00000032469
Gene: ENSMUSG00000030322

DomainStartEndE-ValueType
MBD 66 142 1.25e-29 SMART
low complexity region 178 196 N/A INTRINSIC
PDB:1NGN|A 400 554 1e-111 PDB
SCOP:d1keaa_ 405 545 1e-23 SMART
Blast:ENDO3c 439 514 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122816
SMART Domains Protein: ENSMUSP00000145433
Gene: ENSMUSG00000030322

DomainStartEndE-ValueType
MBD 66 142 7.6e-32 SMART
low complexity region 178 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133830
Predicted Effect probably benign
Transcript: ENSMUST00000147282
SMART Domains Protein: ENSMUSP00000125619
Gene: ENSMUSG00000030322

DomainStartEndE-ValueType
MBD 45 121 1.25e-29 SMART
low complexity region 157 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203620
Predicted Effect probably null
Transcript: ENSMUST00000203643
SMART Domains Protein: ENSMUSP00000144930
Gene: ENSMUSG00000030322

DomainStartEndE-ValueType
Pfam:HhH-GPD 56 168 2.7e-5 PFAM
Meta Mutation Damage Score 0.468 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency 98% (115/117)
MGI Phenotype Strain: 2447611
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele have an increased rate of DNA mutation, specifically at CpGs. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(6) Gene trapped(2)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 11: 76,000,115 probably benign Het
Acsm1 A T 7: 119,658,315 T435S probably damaging Het
Agtpbp1 G A 13: 59,500,200 T602I probably benign Het
Ahnak2 T A 12: 112,785,534 D231V probably damaging Het
Ampd3 G A 7: 110,793,669 D215N probably benign Het
Ankrd17 T C 5: 90,250,405 D1762G probably damaging Het
Asb8 C T 15: 98,142,671 V37I possibly damaging Het
Bicra T C 7: 15,987,511 T694A possibly damaging Het
Btnl6 A T 17: 34,514,299 M234K probably benign Het
Ccnb1 A T 13: 100,779,781 V336D probably damaging Het
Cdca8 A T 4: 124,921,254 L190Q possibly damaging Het
Cep290 A T 10: 100,537,831 L1324F probably damaging Het
Ces1f T C 8: 93,271,885 E161G probably benign Het
Ces2g A G 8: 104,965,996 probably benign Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Clec3b A G 9: 123,157,025 T163A probably benign Het
Cntnap4 T G 8: 112,803,164 L668R probably damaging Het
Col27a1 A G 4: 63,275,977 D857G probably damaging Het
Csf1 A G 3: 107,748,644 V245A probably benign Het
Ctss A G 3: 95,550,137 Y302C probably damaging Het
Cyb5d1 A G 11: 69,394,966 probably null Het
Cyp1a2 A G 9: 57,682,061 S157P probably damaging Het
Cyp2b9 A T 7: 26,200,813 T349S probably benign Het
Dennd6b T C 15: 89,186,183 I428V probably benign Het
Denr A G 5: 123,927,235 probably benign Het
Dnah9 G A 11: 65,969,955 probably benign Het
Dock3 G T 9: 106,913,268 Q1419K possibly damaging Het
Dph3b-ps A T 13: 106,546,867 noncoding transcript Het
Emc7 G T 2: 112,459,485 D87Y probably damaging Het
Enah T C 1: 181,913,373 E462G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Enpp6 A G 8: 47,066,000 K268E probably damaging Het
Eps15l1 T G 8: 72,381,497 probably benign Het
Fam151a T C 4: 106,748,174 Y578H probably benign Het
Fmn2 T C 1: 174,791,314 V1512A probably damaging Het
Focad C A 4: 88,408,959 N168K probably benign Het
Fyco1 A G 9: 123,829,009 C701R probably damaging Het
Gabbr1 G T 17: 37,067,210 probably benign Het
Golga7b A T 19: 42,266,839 E76V probably damaging Het
Gucy2d A G 7: 98,467,752 D924G probably benign Het
H2-M9 A G 17: 36,641,755 F133S probably damaging Het
Hc A G 2: 34,986,292 Y1581H probably damaging Het
Herc3 C T 6: 58,874,308 P514L probably damaging Het
Hormad1 T C 3: 95,585,125 probably benign Het
Iigp1 T A 18: 60,390,787 S326T possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kcnk7 T G 19: 5,707,014 *344G probably null Het
Kif13a A G 13: 46,786,511 probably null Het
Kif1a A C 1: 93,042,358 I1027S probably damaging Het
Kif2c G T 4: 117,165,517 H416Q probably damaging Het
Map3k1 A G 13: 111,756,129 V864A probably benign Het
Mark2 T C 19: 7,285,922 D160G probably damaging Het
Micu1 A G 10: 59,788,877 probably null Het
Mink1 T C 11: 70,613,042 W1263R probably damaging Het
Mov10 A C 3: 104,804,603 L224R probably damaging Het
Ndel1 T C 11: 68,836,173 E226G probably damaging Het
Neb A T 2: 52,222,774 V4336E probably damaging Het
Nln T A 13: 104,036,891 K602N probably damaging Het
Nlrp14 A T 7: 107,181,258 probably benign Het
Nmd3 A T 3: 69,748,321 D445V probably damaging Het
Nop14 T C 5: 34,643,953 I625V probably benign Het
Notch1 T C 2: 26,470,931 Q1134R probably damaging Het
Nr4a2 T C 2: 57,108,615 I392M probably benign Het
Olfr1310 T A 2: 112,009,020 L55F probably damaging Het
Olfr702 A G 7: 106,823,756 F257L possibly damaging Het
Olfr983 A G 9: 40,092,253 S234P probably damaging Het
Osbp T C 19: 11,983,958 Y454H probably damaging Het
Pak4 G A 7: 28,564,283 R343C probably damaging Het
Pak7 T C 2: 136,100,784 K479E possibly damaging Het
Pard3 C A 8: 127,161,308 D73E probably damaging Het
Pcdh10 T C 3: 45,380,499 V416A possibly damaging Het
Plek A C 11: 16,985,594 W261G probably damaging Het
Pmp22 A T 11: 63,158,250 probably null Het
Prph2 A C 17: 46,919,771 K197Q probably benign Het
Prss45 T A 9: 110,840,894 L257Q probably damaging Het
Psmb6 C A 11: 70,526,345 H73Q probably benign Het
Rin2 T C 2: 145,878,832 probably benign Het
Rps6kb1 A T 11: 86,511,587 probably null Het
Scn10a C A 9: 119,670,484 D248Y probably damaging Het
Scn4a C T 11: 106,324,560 V1197I probably benign Het
Siglecf A T 7: 43,351,925 I106F probably benign Het
Sik1 A G 17: 31,847,275 probably benign Het
Slc22a21 T G 11: 53,979,688 N57T probably damaging Het
Slc36a2 A G 11: 55,162,795 L339P probably damaging Het
Slc4a9 G T 18: 36,531,666 probably benign Het
Smg1 G A 7: 118,212,443 T104I possibly damaging Het
Stc2 A T 11: 31,365,559 probably null Het
Stx18 T A 5: 38,092,564 Y74N probably damaging Het
Stxbp5 A T 10: 9,762,748 H1102Q probably damaging Het
Tnfaip8l2 G A 3: 95,140,028 L175F probably damaging Het
Tom1l2 T C 11: 60,230,134 K450E probably damaging Het
Tpo T C 12: 30,100,390 Q497R probably benign Het
Tprgl G T 4: 154,160,345 probably benign Het
Triml2 A G 8: 43,185,432 M146V probably benign Het
Tsc2 A G 17: 24,631,004 probably benign Het
Vit G A 17: 78,599,835 G229R probably benign Het
Vmn2r19 C T 6: 123,331,547 L528F probably benign Het
Vwf T A 6: 125,682,812 I2658N probably benign Het
Wdfy3 T C 5: 101,845,046 D3341G probably damaging Het
Wdr36 T A 18: 32,859,307 D632E probably damaging Het
Wdr47 G T 3: 108,637,991 A733S probably damaging Het
Zcchc6 A T 13: 59,805,328 D99E probably benign Het
Zfp458 T A 13: 67,257,898 H156L probably damaging Het
Zfp654 A G 16: 64,784,818 V466A probably benign Het
Zfp804b T C 5: 6,771,665 E466G probably damaging Het
Zfp941 T C 7: 140,813,272 D58G probably benign Het
Other mutations in Mbd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mbd4 APN 6 115849530 missense probably damaging 0.99
IGL01545:Mbd4 APN 6 115850797 missense probably damaging 1.00
IGL01657:Mbd4 APN 6 115849637 missense probably damaging 0.99
IGL02406:Mbd4 APN 6 115849025 missense possibly damaging 0.96
E0370:Mbd4 UTSW 6 115849155 missense possibly damaging 0.91
R0025:Mbd4 UTSW 6 115844568 critical splice donor site probably null
R0538:Mbd4 UTSW 6 115849482 missense probably damaging 0.99
R2085:Mbd4 UTSW 6 115848957 missense probably benign 0.01
R4405:Mbd4 UTSW 6 115849115 missense possibly damaging 0.92
R4464:Mbd4 UTSW 6 115849502 missense probably damaging 0.99
R4780:Mbd4 UTSW 6 115849384 missense probably benign
R4782:Mbd4 UTSW 6 115845322 missense possibly damaging 0.49
R4799:Mbd4 UTSW 6 115845322 missense probably benign 0.26
R4814:Mbd4 UTSW 6 115849299 missense possibly damaging 0.85
R4860:Mbd4 UTSW 6 115848926 missense possibly damaging 0.51
R4860:Mbd4 UTSW 6 115848926 missense possibly damaging 0.51
R4976:Mbd4 UTSW 6 115850724 missense possibly damaging 0.95
R5126:Mbd4 UTSW 6 115848968 unclassified probably null
R5202:Mbd4 UTSW 6 115849402 missense probably damaging 0.96
R5485:Mbd4 UTSW 6 115850718 missense probably benign 0.21
R6179:Mbd4 UTSW 6 115845425 missense probably benign 0.00
R6661:Mbd4 UTSW 6 115849155 nonsense probably null
R7008:Mbd4 UTSW 6 115850724 missense possibly damaging 0.95
R7244:Mbd4 UTSW 6 115844603 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCTGATTGTAGCCTCGATCACC -3'
(R):5'- CCATTGTTTATGCTCCCCAGGCAAG -3'

Sequencing Primer
(F):5'- CTATGTACAGGGCTACTCAGTG -3'
(R):5'- TCCCCAGGCAAGATGGC -3'
Posted On2013-05-23