Incidental Mutation 'R0025:Kif1a'
ID40740
Institutional Source Beutler Lab
Gene Symbol Kif1a
Ensembl Gene ENSMUSG00000014602
Gene Namekinesin family member 1A
SynonymsLOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1
MMRRC Submission 038320-MU
Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R0025 (G1)
Quality Score122
Status Validated
Chromosome1
Chromosomal Location93015464-93101951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 93042358 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 1027 (I1027S)
Ref Sequence ENSEMBL: ENSMUSP00000084029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]
Predicted Effect probably damaging
Transcript: ENSMUST00000086819
AA Change: I1027S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: I1027S

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 411 429 N/A INTRINSIC
FHA 524 581 1.39e-8 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 6.4e-13 PFAM
Pfam:DUF3694 1157 1305 1.8e-47 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112958
AA Change: I1018S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: I1018S

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 851 3.9e-15 PFAM
Pfam:DUF3694 1148 1304 5e-40 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171556
AA Change: I1018S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: I1018S

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 2.7e-13 PFAM
Pfam:DUF3694 1148 1296 8.4e-48 PFAM
low complexity region 1411 1435 N/A INTRINSIC
low complexity region 1532 1540 N/A INTRINSIC
PH 1575 1674 1.52e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171796
AA Change: I1018S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: I1018S

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 6.4e-13 PFAM
Pfam:DUF3694 1148 1304 1.8e-46 PFAM
low complexity region 1419 1443 N/A INTRINSIC
low complexity region 1540 1548 N/A INTRINSIC
PH 1583 1682 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188493
Predicted Effect probably damaging
Transcript: ENSMUST00000190723
AA Change: I1120S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: I1120S

DomainStartEndE-ValueType
KISc 3 362 5.2e-180 SMART
low complexity region 411 429 N/A INTRINSIC
coiled coil region 438 471 N/A INTRINSIC
FHA 524 581 6.9e-11 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 4e-10 PFAM
low complexity region 885 900 N/A INTRINSIC
coiled coil region 901 929 N/A INTRINSIC
internal_repeat_1 938 957 5.9e-5 PROSPERO
Pfam:DUF3694 1250 1398 1.1e-44 PFAM
low complexity region 1513 1537 N/A INTRINSIC
low complexity region 1634 1642 N/A INTRINSIC
PH 1677 1776 6.9e-16 SMART
Meta Mutation Damage Score 0.552 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency 98% (115/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 11: 76,000,115 probably benign Het
Acsm1 A T 7: 119,658,315 T435S probably damaging Het
Agtpbp1 G A 13: 59,500,200 T602I probably benign Het
Ahnak2 T A 12: 112,785,534 D231V probably damaging Het
Ampd3 G A 7: 110,793,669 D215N probably benign Het
Ankrd17 T C 5: 90,250,405 D1762G probably damaging Het
Asb8 C T 15: 98,142,671 V37I possibly damaging Het
Bicra T C 7: 15,987,511 T694A possibly damaging Het
Btnl6 A T 17: 34,514,299 M234K probably benign Het
Ccnb1 A T 13: 100,779,781 V336D probably damaging Het
Cdca8 A T 4: 124,921,254 L190Q possibly damaging Het
Cep290 A T 10: 100,537,831 L1324F probably damaging Het
Ces1f T C 8: 93,271,885 E161G probably benign Het
Ces2g A G 8: 104,965,996 probably benign Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Clec3b A G 9: 123,157,025 T163A probably benign Het
Cntnap4 T G 8: 112,803,164 L668R probably damaging Het
Col27a1 A G 4: 63,275,977 D857G probably damaging Het
Csf1 A G 3: 107,748,644 V245A probably benign Het
Ctss A G 3: 95,550,137 Y302C probably damaging Het
Cyb5d1 A G 11: 69,394,966 probably null Het
Cyp1a2 A G 9: 57,682,061 S157P probably damaging Het
Cyp2b9 A T 7: 26,200,813 T349S probably benign Het
Dennd6b T C 15: 89,186,183 I428V probably benign Het
Denr A G 5: 123,927,235 probably benign Het
Dnah9 G A 11: 65,969,955 probably benign Het
Dock3 G T 9: 106,913,268 Q1419K possibly damaging Het
Dph3b-ps A T 13: 106,546,867 noncoding transcript Het
Emc7 G T 2: 112,459,485 D87Y probably damaging Het
Enah T C 1: 181,913,373 E462G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Enpp6 A G 8: 47,066,000 K268E probably damaging Het
Eps15l1 T G 8: 72,381,497 probably benign Het
Fam151a T C 4: 106,748,174 Y578H probably benign Het
Fmn2 T C 1: 174,791,314 V1512A probably damaging Het
Focad C A 4: 88,408,959 N168K probably benign Het
Fyco1 A G 9: 123,829,009 C701R probably damaging Het
Gabbr1 G T 17: 37,067,210 probably benign Het
Golga7b A T 19: 42,266,839 E76V probably damaging Het
Gucy2d A G 7: 98,467,752 D924G probably benign Het
H2-M9 A G 17: 36,641,755 F133S probably damaging Het
Hc A G 2: 34,986,292 Y1581H probably damaging Het
Herc3 C T 6: 58,874,308 P514L probably damaging Het
Hormad1 T C 3: 95,585,125 probably benign Het
Iigp1 T A 18: 60,390,787 S326T possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kcnk7 T G 19: 5,707,014 *344G probably null Het
Kif13a A G 13: 46,786,511 probably null Het
Kif2c G T 4: 117,165,517 H416Q probably damaging Het
Map3k1 A G 13: 111,756,129 V864A probably benign Het
Mark2 T C 19: 7,285,922 D160G probably damaging Het
Mbd4 A G 6: 115,844,568 probably null Het
Micu1 A G 10: 59,788,877 probably null Het
Mink1 T C 11: 70,613,042 W1263R probably damaging Het
Mov10 A C 3: 104,804,603 L224R probably damaging Het
Ndel1 T C 11: 68,836,173 E226G probably damaging Het
Neb A T 2: 52,222,774 V4336E probably damaging Het
Nln T A 13: 104,036,891 K602N probably damaging Het
Nlrp14 A T 7: 107,181,258 probably benign Het
Nmd3 A T 3: 69,748,321 D445V probably damaging Het
Nop14 T C 5: 34,643,953 I625V probably benign Het
Notch1 T C 2: 26,470,931 Q1134R probably damaging Het
Nr4a2 T C 2: 57,108,615 I392M probably benign Het
Olfr1310 T A 2: 112,009,020 L55F probably damaging Het
Olfr702 A G 7: 106,823,756 F257L possibly damaging Het
Olfr983 A G 9: 40,092,253 S234P probably damaging Het
Osbp T C 19: 11,983,958 Y454H probably damaging Het
Pak4 G A 7: 28,564,283 R343C probably damaging Het
Pak7 T C 2: 136,100,784 K479E possibly damaging Het
Pard3 C A 8: 127,161,308 D73E probably damaging Het
Pcdh10 T C 3: 45,380,499 V416A possibly damaging Het
Plek A C 11: 16,985,594 W261G probably damaging Het
Pmp22 A T 11: 63,158,250 probably null Het
Prph2 A C 17: 46,919,771 K197Q probably benign Het
Prss45 T A 9: 110,840,894 L257Q probably damaging Het
Psmb6 C A 11: 70,526,345 H73Q probably benign Het
Rin2 T C 2: 145,878,832 probably benign Het
Rps6kb1 A T 11: 86,511,587 probably null Het
Scn10a C A 9: 119,670,484 D248Y probably damaging Het
Scn4a C T 11: 106,324,560 V1197I probably benign Het
Siglecf A T 7: 43,351,925 I106F probably benign Het
Sik1 A G 17: 31,847,275 probably benign Het
Slc22a21 T G 11: 53,979,688 N57T probably damaging Het
Slc36a2 A G 11: 55,162,795 L339P probably damaging Het
Slc4a9 G T 18: 36,531,666 probably benign Het
Smg1 G A 7: 118,212,443 T104I possibly damaging Het
Stc2 A T 11: 31,365,559 probably null Het
Stx18 T A 5: 38,092,564 Y74N probably damaging Het
Stxbp5 A T 10: 9,762,748 H1102Q probably damaging Het
Tnfaip8l2 G A 3: 95,140,028 L175F probably damaging Het
Tom1l2 T C 11: 60,230,134 K450E probably damaging Het
Tpo T C 12: 30,100,390 Q497R probably benign Het
Tprgl G T 4: 154,160,345 probably benign Het
Triml2 A G 8: 43,185,432 M146V probably benign Het
Tsc2 A G 17: 24,631,004 probably benign Het
Vit G A 17: 78,599,835 G229R probably benign Het
Vmn2r19 C T 6: 123,331,547 L528F probably benign Het
Vwf T A 6: 125,682,812 I2658N probably benign Het
Wdfy3 T C 5: 101,845,046 D3341G probably damaging Het
Wdr36 T A 18: 32,859,307 D632E probably damaging Het
Wdr47 G T 3: 108,637,991 A733S probably damaging Het
Zcchc6 A T 13: 59,805,328 D99E probably benign Het
Zfp458 T A 13: 67,257,898 H156L probably damaging Het
Zfp654 A G 16: 64,784,818 V466A probably benign Het
Zfp804b T C 5: 6,771,665 E466G probably damaging Het
Zfp941 T C 7: 140,813,272 D58G probably benign Het
Other mutations in Kif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kif1a APN 1 93054934 missense probably damaging 1.00
IGL01574:Kif1a APN 1 93082340 missense probably damaging 1.00
IGL01637:Kif1a APN 1 93039853 missense possibly damaging 0.95
IGL01895:Kif1a APN 1 93025733 missense possibly damaging 0.65
IGL02215:Kif1a APN 1 93020549 missense probably benign 0.05
IGL02571:Kif1a APN 1 93020456 critical splice donor site probably null
IGL02734:Kif1a APN 1 93062558 missense probably damaging 1.00
IGL02752:Kif1a APN 1 93039847 missense possibly damaging 0.92
IGL02990:Kif1a APN 1 93039263 missense probably damaging 1.00
IGL03298:Kif1a APN 1 93066181 missense probably damaging 1.00
IGL03309:Kif1a APN 1 93058857 nonsense probably null
IGL03354:Kif1a APN 1 93060235 missense probably damaging 1.00
asbestos UTSW 1 93022505 missense probably damaging 1.00
chrysolite UTSW 1 93074948 splice site probably benign
osmium UTSW 1 93058810 splice site probably benign
1mM(1):Kif1a UTSW 1 93077068 missense probably benign 0.00
IGL03046:Kif1a UTSW 1 93082406 missense probably damaging 1.00
PIT4508001:Kif1a UTSW 1 93046729 missense probably damaging 1.00
R0115:Kif1a UTSW 1 93046778 splice site probably benign
R0243:Kif1a UTSW 1 93042093 missense probably damaging 1.00
R0270:Kif1a UTSW 1 93054442 splice site probably benign
R0335:Kif1a UTSW 1 93052566 splice site probably benign
R0380:Kif1a UTSW 1 93056031 critical splice acceptor site probably null
R0472:Kif1a UTSW 1 93018997 missense probably damaging 0.99
R0501:Kif1a UTSW 1 93056245 missense probably damaging 1.00
R0538:Kif1a UTSW 1 93043638 missense probably damaging 0.99
R0628:Kif1a UTSW 1 93019883 missense probably damaging 1.00
R0848:Kif1a UTSW 1 93019898 missense probably damaging 1.00
R1110:Kif1a UTSW 1 93023453 splice site probably benign
R1132:Kif1a UTSW 1 93056021 missense probably damaging 0.99
R1387:Kif1a UTSW 1 93055950 splice site probably benign
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1544:Kif1a UTSW 1 93074948 splice site probably benign
R1569:Kif1a UTSW 1 93058810 splice site probably benign
R1802:Kif1a UTSW 1 93066149 missense probably damaging 1.00
R1917:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1919:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1999:Kif1a UTSW 1 93060795 missense probably damaging 0.98
R2000:Kif1a UTSW 1 93054329 missense probably damaging 0.99
R2276:Kif1a UTSW 1 93068477 splice site probably benign
R2307:Kif1a UTSW 1 93078769 missense probably damaging 1.00
R2919:Kif1a UTSW 1 93046742 missense probably damaging 1.00
R3440:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3441:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3618:Kif1a UTSW 1 93077043 missense probably null 1.00
R3957:Kif1a UTSW 1 93025694 missense probably damaging 1.00
R4010:Kif1a UTSW 1 93022409 missense probably benign 0.42
R4013:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4017:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4115:Kif1a UTSW 1 93052538 missense probably damaging 1.00
R4386:Kif1a UTSW 1 93068550 missense probably damaging 1.00
R4538:Kif1a UTSW 1 93077047 missense probably damaging 1.00
R4608:Kif1a UTSW 1 93024646 missense possibly damaging 0.81
R4625:Kif1a UTSW 1 93042659 missense probably benign 0.00
R4701:Kif1a UTSW 1 93078835 missense probably damaging 0.99
R4794:Kif1a UTSW 1 93025727 missense probably damaging 1.00
R4830:Kif1a UTSW 1 93021209 splice site probably null
R4903:Kif1a UTSW 1 93021734 missense probably damaging 1.00
R4915:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4918:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4991:Kif1a UTSW 1 93078808 missense probably benign 0.00
R5028:Kif1a UTSW 1 93054327 missense possibly damaging 0.68
R5051:Kif1a UTSW 1 93076154 unclassified probably null
R5073:Kif1a UTSW 1 93022505 missense probably damaging 1.00
R5103:Kif1a UTSW 1 93046696 missense probably damaging 1.00
R5314:Kif1a UTSW 1 93018498 missense probably damaging 1.00
R5481:Kif1a UTSW 1 93060244 missense probably benign 0.01
R5510:Kif1a UTSW 1 93041692 missense possibly damaging 0.93
R5610:Kif1a UTSW 1 93025728 missense probably damaging 1.00
R5643:Kif1a UTSW 1 93055767 missense probably damaging 0.98
R5808:Kif1a UTSW 1 93042698 missense probably damaging 0.99
R6027:Kif1a UTSW 1 93025643 missense probably benign 0.33
R6056:Kif1a UTSW 1 93024648 missense probably damaging 1.00
R6077:Kif1a UTSW 1 93054896 missense possibly damaging 0.54
R6120:Kif1a UTSW 1 93024574 splice site probably null
R6126:Kif1a UTSW 1 93019899 missense probably damaging 1.00
R6130:Kif1a UTSW 1 93036901 missense probably damaging 1.00
R6255:Kif1a UTSW 1 93019983 missense probably damaging 1.00
R6301:Kif1a UTSW 1 93054941 nonsense probably null
R6326:Kif1a UTSW 1 93076326 missense probably damaging 1.00
R6594:Kif1a UTSW 1 93021313 missense probably benign 0.00
R6653:Kif1a UTSW 1 93077698 missense probably damaging 1.00
R6791:Kif1a UTSW 1 93066137 missense probably damaging 1.00
R6853:Kif1a UTSW 1 93039802 missense possibly damaging 0.47
R7022:Kif1a UTSW 1 93066098 missense probably benign 0.31
R7059:Kif1a UTSW 1 93046829 intron probably benign
R7103:Kif1a UTSW 1 93077785 missense probably damaging 1.00
R7248:Kif1a UTSW 1 93041583 missense probably benign 0.35
R7259:Kif1a UTSW 1 93073810 nonsense probably null
R7424:Kif1a UTSW 1 93054317 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGGGCCAGCACTTACATTTTGGAC -3'
(R):5'- CCAGGGCTTGAAGAGCATGGAATC -3'

Sequencing Primer
(F):5'- CATTTTGGACATGGTAGAAGCC -3'
(R):5'- AGACCCCCATCGCTCTG -3'
Posted On2013-05-23