Incidental Mutation 'R5326:Adgrf5'
ID421998
Institutional Source Beutler Lab
Gene Symbol Adgrf5
Ensembl Gene ENSMUSG00000056492
Gene Nameadhesion G protein-coupled receptor F5
SynonymsGpr116, 8430401C09Rik
MMRRC Submission 042909-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5326 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43360451-43459557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43440074 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 510 (I510N)
Ref Sequence ENSEMBL: ENSMUSP00000153049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225004] [ENSMUST00000225962] [ENSMUST00000226087]
Predicted Effect probably damaging
Transcript: ENSMUST00000113599
AA Change: I510N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: I510N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 118 161 8e-14 BLAST
Pfam:SEA 165 263 9.2e-14 PFAM
IG 276 366 1.54e-4 SMART
Blast:IG_like 374 464 2e-31 BLAST
IG 475 561 1.04e-1 SMART
low complexity region 815 823 N/A INTRINSIC
GPS 949 1004 6.49e-16 SMART
Pfam:7tm_2 1011 1264 1.2e-35 PFAM
low complexity region 1328 1347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225004
Predicted Effect probably damaging
Transcript: ENSMUST00000225962
AA Change: I305N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000226087
AA Change: I510N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,354 T127A probably damaging Het
9530053A07Rik A T 7: 28,155,489 I1847F probably damaging Het
Aadacl2 C T 3: 60,025,063 T333I probably damaging Het
Actl6b T C 5: 137,567,051 S366P probably damaging Het
Actr10 T C 12: 70,954,656 probably benign Het
Adra2a A G 19: 54,046,681 Y156C probably damaging Het
Angpt4 T C 2: 151,925,544 probably null Het
Ankdd1a T A 9: 65,504,190 probably null Het
AW146154 C A 7: 41,481,377 G105V probably benign Het
Brd3 A G 2: 27,450,544 L551P probably benign Het
Calb2 C T 8: 110,156,978 G38D possibly damaging Het
Cand1 G A 10: 119,212,028 A519V probably benign Het
Cnbd1 T C 4: 18,860,517 T410A possibly damaging Het
Cndp2 A T 18: 84,672,076 M247K probably damaging Het
Cog6 T A 3: 53,013,816 Q123L probably null Het
Crx G A 7: 15,868,337 R139C probably damaging Het
Ctrc A G 4: 141,843,726 Y68H probably damaging Het
Ddx4 T C 13: 112,621,245 D326G probably damaging Het
Depdc1a T C 3: 159,526,649 V679A probably damaging Het
Dyrk1a A G 16: 94,686,581 D512G probably damaging Het
Edem1 C T 6: 108,854,329 R584C possibly damaging Het
Emcn A G 3: 137,379,877 T79A probably benign Het
Fbrsl1 C T 5: 110,378,441 G437R probably damaging Het
Fbxo9 T C 9: 78,101,656 M12V possibly damaging Het
Flii A G 11: 60,718,862 S640P probably benign Het
Frs2 T C 10: 117,077,563 S121G probably benign Het
Fsip2 A T 2: 82,981,863 N2842I possibly damaging Het
Fst G T 13: 114,455,705 Q159K probably damaging Het
Ggt1 T C 10: 75,585,706 probably null Het
Gigyf2 T C 1: 87,425,138 probably benign Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm9476 T A 10: 100,307,134 noncoding transcript Het
Gm9992 A T 17: 7,369,788 C334S probably benign Het
Gmcl1 A T 6: 86,726,145 N102K possibly damaging Het
Gml T C 15: 74,816,450 N56S probably damaging Het
Gpam A C 19: 55,091,165 S128R probably benign Het
Gucy1b2 C T 14: 62,453,330 probably null Het
Hhipl2 A G 1: 183,433,146 D377G probably damaging Het
Hmx3 C T 7: 131,544,417 Q285* probably null Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Ighv5-17 T C 12: 113,859,258 D81G possibly damaging Het
Ipo5 T C 14: 120,926,271 V247A probably benign Het
Iqcd A G 5: 120,602,375 Q257R probably damaging Het
Itpk1 T C 12: 102,573,966 N286S possibly damaging Het
Knl1 T A 2: 119,068,348 C177S possibly damaging Het
Knop1 T C 7: 118,853,272 K23E possibly damaging Het
Ksr2 T A 5: 117,708,240 V724E probably damaging Het
Lrrc17 G A 5: 21,575,158 G377S probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Morc2b T A 17: 33,136,933 T622S probably benign Het
Msantd2 G A 9: 37,517,259 G185R probably damaging Het
Mtmr2 A G 9: 13,788,647 Y38C probably damaging Het
Mycbpap A T 11: 94,507,746 probably null Het
Nadsyn1 T A 7: 143,808,830 R279W probably benign Het
Olfr1354 G A 10: 78,917,586 V249I possibly damaging Het
Olfr330 A C 11: 58,529,884 V34G probably benign Het
Olfr384 T A 11: 73,603,204 V208E possibly damaging Het
Olfr689 T A 7: 105,314,439 F145Y probably damaging Het
Pcdhga4 A T 18: 37,686,598 Y400F probably damaging Het
Pkd2 A G 5: 104,486,649 silent Het
Prkar1b T C 5: 139,127,789 probably null Het
Ric8b T C 10: 84,992,212 Y467H probably damaging Het
Rin1 A G 19: 5,052,624 E387G probably damaging Het
Robo2 G A 16: 73,898,965 T1430I probably benign Het
Seh1l C T 18: 67,774,999 probably benign Het
Slc37a1 A T 17: 31,340,262 T439S probably damaging Het
Slc6a6 T C 6: 91,735,189 F233S probably damaging Het
Smyd3 A T 1: 179,410,459 D114E probably benign Het
Snrnp70 GCGGTCCCGGTCCCGGTC GCGGTCCCGGTC 7: 45,377,233 probably benign Het
Speer4a T A 5: 26,036,738 N130I probably damaging Het
Spin1 A G 13: 51,139,527 Y91C probably damaging Het
Tdrd7 T C 4: 46,029,757 V1030A probably benign Het
Trim30c T A 7: 104,388,304 M152L possibly damaging Het
Tsga10 T A 1: 37,761,517 D542V probably damaging Het
Vmn1r175 A T 7: 23,809,106 I32N possibly damaging Het
Vmn1r81 A T 7: 12,260,107 D191E probably damaging Het
Wdr11 T C 7: 129,625,249 S812P probably damaging Het
Zbtb5 C A 4: 44,995,052 V111F probably damaging Het
Zdbf2 T G 1: 63,304,411 C650G possibly damaging Het
Zfp282 T A 6: 47,905,327 N649K probably benign Het
Other mutations in Adgrf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adgrf5 APN 17 43449915 missense possibly damaging 0.79
IGL00590:Adgrf5 APN 17 43453147 missense probably damaging 1.00
IGL01128:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01131:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01132:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01392:Adgrf5 APN 17 43450012 missense probably benign 0.00
IGL01475:Adgrf5 APN 17 43450354 missense probably benign 0.00
IGL01614:Adgrf5 APN 17 43424471 missense possibly damaging 0.53
IGL01654:Adgrf5 APN 17 43451170 missense possibly damaging 0.89
IGL02053:Adgrf5 APN 17 43450167 missense possibly damaging 0.47
IGL02175:Adgrf5 APN 17 43451010 missense probably damaging 1.00
IGL02416:Adgrf5 APN 17 43444980 splice site probably null
IGL02525:Adgrf5 APN 17 43449963 missense probably damaging 1.00
IGL03035:Adgrf5 APN 17 43430627 missense possibly damaging 0.80
duct_tape UTSW 17 43445115 missense probably benign 0.04
Flypaper UTSW 17 43422661 splice site probably benign
motel UTSW 17 43450380 missense probably damaging 1.00
Schmutzfinger UTSW 17 43424818 nonsense probably null
sticky UTSW 17 43437571 missense probably damaging 0.98
sweetie UTSW 17 43450983 missense probably damaging 0.96
PIT4812001:Adgrf5 UTSW 17 43450369 missense probably damaging 1.00
R0699:Adgrf5 UTSW 17 43422661 splice site probably null
R0972:Adgrf5 UTSW 17 43450983 missense probably damaging 0.96
R1521:Adgrf5 UTSW 17 43430552 missense probably benign 0.03
R1523:Adgrf5 UTSW 17 43450153 missense probably benign 0.00
R1758:Adgrf5 UTSW 17 43424593 critical splice donor site probably null
R1767:Adgrf5 UTSW 17 43450564 missense possibly damaging 0.87
R1799:Adgrf5 UTSW 17 43440067 missense probably damaging 0.98
R1800:Adgrf5 UTSW 17 43451082 missense probably damaging 1.00
R1888:Adgrf5 UTSW 17 43427005 unclassified probably null
R1888:Adgrf5 UTSW 17 43427005 unclassified probably null
R2057:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2058:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2059:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2410:Adgrf5 UTSW 17 43455266 missense probably benign 0.11
R2568:Adgrf5 UTSW 17 43437671 missense probably damaging 1.00
R2847:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R2848:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R3800:Adgrf5 UTSW 17 43447060 splice site probably benign
R3856:Adgrf5 UTSW 17 43447036 missense possibly damaging 0.93
R4021:Adgrf5 UTSW 17 43430714 splice site probably benign
R4075:Adgrf5 UTSW 17 43450195 missense probably damaging 1.00
R4366:Adgrf5 UTSW 17 43441969 missense probably damaging 0.99
R4409:Adgrf5 UTSW 17 43441847 missense probably damaging 1.00
R4570:Adgrf5 UTSW 17 43445115 missense probably benign 0.04
R4616:Adgrf5 UTSW 17 43452440 missense probably benign 0.38
R4623:Adgrf5 UTSW 17 43450983 missense probably benign 0.16
R4645:Adgrf5 UTSW 17 43437525 missense probably damaging 1.00
R5211:Adgrf5 UTSW 17 43422620 missense probably benign 0.32
R5268:Adgrf5 UTSW 17 43450999 missense probably damaging 1.00
R5280:Adgrf5 UTSW 17 43426334 missense probably damaging 1.00
R5762:Adgrf5 UTSW 17 43430695 missense probably null 0.16
R5856:Adgrf5 UTSW 17 43446120 missense probably benign 0.09
R6007:Adgrf5 UTSW 17 43437571 missense probably damaging 0.98
R6153:Adgrf5 UTSW 17 43451083 missense possibly damaging 0.96
R6451:Adgrf5 UTSW 17 43424818 nonsense probably null
R6535:Adgrf5 UTSW 17 43440029 missense probably benign 0.05
R6536:Adgrf5 UTSW 17 43422661 splice site probably benign
R6602:Adgrf5 UTSW 17 43450304 missense probably benign 0.32
R6882:Adgrf5 UTSW 17 43450380 missense probably damaging 1.00
R6992:Adgrf5 UTSW 17 43452323 critical splice donor site probably null
R7137:Adgrf5 UTSW 17 43450897 missense probably damaging 1.00
R7170:Adgrf5 UTSW 17 43446138 missense possibly damaging 0.92
R7313:Adgrf5 UTSW 17 43445083 missense probably benign 0.01
R7313:Adgrf5 UTSW 17 43452477 critical splice donor site probably null
X0017:Adgrf5 UTSW 17 43427045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCCGTGTCGATGTCATC -3'
(R):5'- TGTCCTGTCACCCACAAAG -3'

Sequencing Primer
(F):5'- AAACTAAACATTGCATCTATTGTTGG -3'
(R):5'- TGTCACCCACAAAGAGTAATTAATC -3'
Posted On2016-08-04