Incidental Mutation 'R5384:Il23r'
ID424923
Institutional Source Beutler Lab
Gene Symbol Il23r
Ensembl Gene ENSMUSG00000049093
Gene Nameinterleukin 23 receptor
Synonyms
Accession Numbers

Ncbi RefSeq: NM_144548.1; MGI:2181693

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R5384 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location67422932-67491855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67486291 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 73 (H73Y)
Ref Sequence ENSEMBL: ENSMUSP00000113342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118364]
Predicted Effect probably benign
Transcript: ENSMUST00000118364
AA Change: H73Y

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093
AA Change: H73Y

DomainStartEndE-ValueType
FN3 140 220 1e-1 SMART
Blast:FN3 235 317 2e-38 BLAST
transmembrane domain 388 410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype Strain: 4355925
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,960 V246A probably benign Het
Abcc10 T C 17: 46,304,435 S1343G possibly damaging Het
Abcd3 C A 3: 121,761,410 probably null Het
Actl6a T A 3: 32,720,493 M335K probably damaging Het
Adamts9 A C 6: 92,798,018 C1090W probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Apeh A T 9: 108,086,463 L551H probably damaging Het
Avpr1a T A 10: 122,449,369 F189I probably damaging Het
BC034090 T A 1: 155,242,027 H115L possibly damaging Het
C4b A T 17: 34,737,661 D654E possibly damaging Het
Carns1 T A 19: 4,171,901 probably null Het
Ccdc146 T A 5: 21,308,713 E469V probably benign Het
Cdc27 A G 11: 104,507,140 I804T probably benign Het
Cdh23 G A 10: 60,337,762 T1651I probably damaging Het
Cenpo G A 12: 4,216,646 P154L probably damaging Het
Cenpu G A 8: 46,562,499 G150R probably benign Het
Chrna10 C A 7: 102,114,353 L78F probably damaging Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cidea A T 18: 67,360,166 D85V probably damaging Het
Cldn18 T C 9: 99,709,858 S31G possibly damaging Het
Clpb T A 7: 101,779,341 I436N probably damaging Het
Col11a2 T C 17: 34,059,174 probably null Het
Cul7 T C 17: 46,654,477 V527A probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dchs1 T A 7: 105,772,055 D386V probably damaging Het
Dcstamp A C 15: 39,759,319 Q345H probably damaging Het
Dlgap3 A G 4: 127,236,330 I955V probably damaging Het
Dvl1 A G 4: 155,853,686 D97G probably damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Efr3b G T 12: 3,983,419 F129L probably benign Het
Etaa1 G A 11: 17,947,539 L193F probably damaging Het
Fam13c G A 10: 70,553,069 S474N probably benign Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fastkd3 T C 13: 68,584,585 F342L probably benign Het
Fat4 T C 3: 38,995,946 S3986P possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fgr G A 4: 132,986,353 probably null Het
Gbx2 T C 1: 89,928,913 T252A probably damaging Het
Gm20671 A G 5: 32,819,942 S1823P probably damaging Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gsdma A T 11: 98,666,449 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac9 A G 12: 34,429,558 Y223H probably damaging Het
Igsf5 C A 16: 96,391,026 T275N probably benign Het
Ipo4 G T 14: 55,626,196 R1026S probably benign Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Khdrbs1 G T 4: 129,741,936 D75E possibly damaging Het
Lrwd1 A T 5: 136,123,874 D511E possibly damaging Het
Ly75 A T 2: 60,334,487 C782* probably null Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myh10 T A 11: 68,801,608 L1369Q probably damaging Het
Myof C T 19: 37,952,987 A792T probably damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Ncoa7 C A 10: 30,722,817 A37S probably benign Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Nr1d2 A T 14: 18,211,922 S394T probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1252 T A 2: 89,721,305 I269F possibly damaging Het
Olfr1508 T A 14: 52,463,257 T251S probably benign Het
Olfr165 A G 16: 19,407,797 L73P probably damaging Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Pate2 A G 9: 35,670,541 M44V probably damaging Het
Pikfyve T C 1: 65,244,409 L735S probably damaging Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld1 C A 3: 28,025,320 R90S probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppm1d A G 11: 85,311,783 E104G probably damaging Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Ppp1r42 A G 1: 9,999,435 L134P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss36 C A 7: 127,936,699 R288L probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Psma3 G T 12: 70,974,765 G7W probably damaging Het
Psmc3ip A T 11: 101,092,604 probably null Het
Qser1 T C 2: 104,786,642 E1275G probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rcc2 A T 4: 140,720,566 K468* probably null Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sec1 C A 7: 45,678,840 R261L probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Homo
Sgip1 G A 4: 102,934,566 V362I possibly damaging Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc12a9 A T 5: 137,331,014 L126Q probably damaging Het
Slx4 A G 16: 3,990,805 S424P probably damaging Het
Smg5 T C 3: 88,351,293 S524P probably damaging Het
Sncaip A G 18: 52,885,041 D418G probably damaging Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Spata31d1b C A 13: 59,718,218 T1060K possibly damaging Het
Spink6 A G 18: 44,082,280 T66A probably damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stk39 T A 2: 68,410,039 D116V probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Svep1 T C 4: 58,104,545 K1226R possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tas2r117 G T 6: 132,803,154 S85I probably benign Het
Tcf20 T A 15: 82,856,199 Q350H probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfb2m A C 1: 179,545,872 probably null Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Trappc8 A T 18: 20,833,062 probably null Het
Trbv30 A G 6: 41,281,920 T88A probably benign Het
Trim40 T A 17: 36,888,865 N107I probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Ttn A G 2: 76,878,348 probably benign Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn1r42 T A 6: 89,845,384 I68F probably damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa7 G T 17: 35,024,926 probably null Het
Xndc1 T C 7: 102,082,188 V378A probably benign Het
Zc3h12d A T 10: 7,853,250 D126V probably damaging Het
Zc3h13 A G 14: 75,343,619 N1682S probably benign Het
Zc3h15 T C 2: 83,660,230 I236T possibly damaging Het
Zfp13 A T 17: 23,581,182 I34N probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfyve28 A G 5: 34,216,967 C568R probably damaging Het
Other mutations in Il23r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Il23r APN 6 67423628 missense probably damaging 0.96
IGL00886:Il23r APN 6 67473890 missense possibly damaging 0.94
IGL00916:Il23r APN 6 67473931 missense probably damaging 1.00
IGL01102:Il23r APN 6 67423925 missense probably damaging 0.98
IGL01466:Il23r APN 6 67426642 missense probably benign 0.30
IGL01627:Il23r APN 6 67423428 missense probably benign 0.17
IGL02160:Il23r APN 6 67423578 missense probably benign 0.09
IGL02394:Il23r APN 6 67466272 splice site probably benign
IGL02418:Il23r APN 6 67490672 missense possibly damaging 0.46
IGL02818:Il23r APN 6 67486094 critical splice donor site probably null
IGL03230:Il23r APN 6 67423964 missense probably benign 0.31
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0085:Il23r UTSW 6 67486222 missense probably damaging 1.00
R0477:Il23r UTSW 6 67452377 missense probably benign 0.00
R0534:Il23r UTSW 6 67426588 missense probably benign 0.00
R0547:Il23r UTSW 6 67423701 missense probably benign 0.05
R0547:Il23r UTSW 6 67486251 missense possibly damaging 0.57
R0666:Il23r UTSW 6 67434680 missense probably benign 0.08
R0702:Il23r UTSW 6 67466285 missense probably damaging 0.97
R0715:Il23r UTSW 6 67486333 missense possibly damaging 0.63
R1077:Il23r UTSW 6 67473810 missense probably benign 0.40
R1202:Il23r UTSW 6 67478953 missense possibly damaging 0.95
R1328:Il23r UTSW 6 67491818 start gained probably benign
R1378:Il23r UTSW 6 67452410 missense possibly damaging 0.68
R1420:Il23r UTSW 6 67486197 missense probably damaging 1.00
R1475:Il23r UTSW 6 67452296 critical splice donor site probably null
R1628:Il23r UTSW 6 67423609 missense probably damaging 1.00
R1745:Il23r UTSW 6 67466291 missense probably damaging 0.98
R1887:Il23r UTSW 6 67473801 missense possibly damaging 0.88
R1901:Il23r UTSW 6 67423734 missense probably benign 0.44
R1902:Il23r UTSW 6 67423734 missense probably benign 0.44
R1928:Il23r UTSW 6 67423735 missense possibly damaging 0.79
R1984:Il23r UTSW 6 67490668 splice site probably null
R1985:Il23r UTSW 6 67490668 splice site probably null
R2264:Il23r UTSW 6 67426667 critical splice acceptor site probably null
R2290:Il23r UTSW 6 67423861 missense probably benign 0.17
R2363:Il23r UTSW 6 67452417 missense probably benign 0.08
R3430:Il23r UTSW 6 67452474 missense probably benign 0.08
R3964:Il23r UTSW 6 67466297 missense probably benign 0.13
R4073:Il23r UTSW 6 67486122 missense probably damaging 1.00
R4164:Il23r UTSW 6 67423663 missense probably benign 0.00
R4643:Il23r UTSW 6 67423993 missense probably benign 0.08
R4700:Il23r UTSW 6 67473850 missense probably damaging 1.00
R4703:Il23r UTSW 6 67490702 missense probably damaging 1.00
R4720:Il23r UTSW 6 67423661 missense probably damaging 1.00
R4828:Il23r UTSW 6 67431651 missense probably benign 0.31
R4911:Il23r UTSW 6 67423561 missense probably benign 0.17
R5119:Il23r UTSW 6 67466316 missense probably damaging 1.00
R5152:Il23r UTSW 6 67423741 missense probably damaging 0.98
R5223:Il23r UTSW 6 67486170 missense probably benign 0.23
R5271:Il23r UTSW 6 67423696 missense probably benign 0.16
R5330:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5331:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5874:Il23r UTSW 6 67431645 missense possibly damaging 0.92
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6377:Il23r UTSW 6 67423652 missense probably damaging 0.99
R6925:Il23r UTSW 6 67423493 missense probably damaging 1.00
R6975:Il23r UTSW 6 67423368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTTCCCACAAATCAGTGTC -3'
(R):5'- AAGCTGAAAGGCTGCATCC -3'

Sequencing Primer
(F):5'- CAGTGTCTCTTGAAAATGACCAGGAC -3'
(R):5'- AAATGAGTTTTACCTGCAGTAGC -3'
Posted On2016-08-04