Incidental Mutation 'R5391:Gdf9'
ID425864
Institutional Source Beutler Lab
Gene Symbol Gdf9
Ensembl Gene ENSMUSG00000018238
Gene Namegrowth differentiation factor 9
SynonymsGdf-9
MMRRC Submission 042963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5391 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53431023-53437904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53433797 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000018382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018382] [ENSMUST00000061326] [ENSMUST00000109019] [ENSMUST00000109021]
Predicted Effect probably benign
Transcript: ENSMUST00000018382
AA Change: V131A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018382
Gene: ENSMUSG00000018238
AA Change: V131A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TGFB 340 441 3.16e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061326
SMART Domains Protein: ENSMUSP00000053145
Gene: ENSMUSG00000044894

DomainStartEndE-ValueType
Pfam:UcrQ 2 81 3.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109019
Predicted Effect probably benign
Transcript: ENSMUST00000109021
SMART Domains Protein: ENSMUSP00000104649
Gene: ENSMUSG00000044894

DomainStartEndE-ValueType
Pfam:UcrQ 2 81 3.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156503
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates ovarian function. Female mice that are homozygous null for this gene are sterile with impaired folliculogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Females homozygous for a targeted null mutation are sterile with a block in folliculogenesis. Mutant oocytes exhibit perinuclear organelle aggregation, unusual Golgi complexes, absence of cortical granules, and impaired granulosa cell connections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,805,481 M38I probably null Het
Actl7a A G 4: 56,743,661 T63A probably benign Het
Amfr G A 8: 93,976,048 P497S probably damaging Het
Ankrd33b T C 15: 31,325,206 I122V probably damaging Het
Asap1 G T 15: 64,094,052 T1011K possibly damaging Het
Cbfa2t3 G A 8: 122,633,395 R506* probably null Het
Ccdc105 G A 10: 78,752,854 Q41* probably null Het
Ccs C G 19: 4,833,482 C96S probably benign Het
Cpt1a A G 19: 3,349,260 D20G probably damaging Het
Ctdspl2 G A 2: 122,004,148 probably null Het
Dhx57 T C 17: 80,275,081 Y365C probably damaging Het
Dnah3 C T 7: 120,090,076 M38I probably benign Het
Dnajc6 T C 4: 101,628,158 probably null Het
Elac2 A G 11: 64,994,294 S450G probably benign Het
Il12rb2 T C 6: 67,292,420 N803S probably benign Het
Itgb4 T A 11: 115,985,068 M477K probably benign Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Krt78 C A 15: 101,951,828 E218* probably null Het
Lpar1 A G 4: 58,486,902 L105P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Mov10 G A 3: 104,802,533 H346Y probably benign Het
Nfia A G 4: 97,783,301 I83V probably damaging Het
Olfr1453 G T 19: 13,027,786 A181E probably damaging Het
Olfr215 T C 6: 116,582,847 Y33C probably damaging Het
Pcdhgb6 T G 18: 37,742,587 I116S probably damaging Het
Pdcd6ip G T 9: 113,691,518 Q133K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Pik3cd A T 4: 149,659,131 V207E probably damaging Het
Ptov1 T C 7: 44,863,584 Q397R probably damaging Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rasl12 G T 9: 65,398,667 A35S probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sec16a A G 2: 26,440,032 V657A possibly damaging Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Tbce T C 13: 14,005,965 I293M probably damaging Het
Tmem176a T C 6: 48,844,696 L204P probably damaging Het
Tmem87a A G 2: 120,362,877 probably null Het
Tns1 A T 1: 73,990,409 probably null Het
Usf3 T A 16: 44,217,463 S769T probably benign Het
Vmn2r82 A G 10: 79,356,657 T23A probably null Het
Vps26a A G 10: 62,456,747 *328Q probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wwc2 A T 8: 47,863,871 I729K unknown Het
Zbtb44 A G 9: 31,053,305 probably null Het
Zfp800 A T 6: 28,242,993 S658T probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zfp935 G T 13: 62,454,818 Y189* probably null Het
Zkscan1 T A 5: 138,097,101 H203Q probably benign Het
Zkscan14 T C 5: 145,195,794 D309G probably benign Het
Other mutations in Gdf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Gdf9 APN 11 53436742 missense probably benign 0.02
R0688:Gdf9 UTSW 11 53436640 missense probably damaging 1.00
R1607:Gdf9 UTSW 11 53437511 missense possibly damaging 0.79
R1651:Gdf9 UTSW 11 53433749 missense probably damaging 0.98
R1902:Gdf9 UTSW 11 53436953 missense probably benign 0.26
R2128:Gdf9 UTSW 11 53437507 missense probably damaging 1.00
R5360:Gdf9 UTSW 11 53437207 missense probably benign 0.42
R5395:Gdf9 UTSW 11 53433797 missense probably benign
R5470:Gdf9 UTSW 11 53436754 missense probably benign 0.11
R5593:Gdf9 UTSW 11 53433731 missense probably damaging 0.99
R5809:Gdf9 UTSW 11 53433554 missense probably benign 0.03
R5829:Gdf9 UTSW 11 53433689 missense probably benign 0.03
R6394:Gdf9 UTSW 11 53436697 missense probably damaging 1.00
R6442:Gdf9 UTSW 11 53433688 missense probably benign 0.00
R6894:Gdf9 UTSW 11 53436819 missense possibly damaging 0.80
R7171:Gdf9 UTSW 11 53437539 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATCTGATAGGCGAGGTGAGAC -3'
(R):5'- GTTGGACACTGAGAATCATGC -3'

Sequencing Primer
(F):5'- TGAGACCCCTAAGCTGCAG -3'
(R):5'- TGATTCCAGTACTTAAGGAGCCG -3'
Posted On2016-08-04