Incidental Mutation 'R5533:Srpk1'
ID433781
Institutional Source Beutler Lab
Gene Symbol Srpk1
Ensembl Gene ENSMUSG00000004865
Gene Nameserine/arginine-rich protein specific kinase 1
SynonymsSR protein-specific kinase 1
MMRRC Submission 043091-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.782) question?
Stock #R5533 (G1)
Quality Score186
Status Not validated
Chromosome17
Chromosomal Location28587648-28622521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28602759 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 227 (Y227C)
Ref Sequence ENSEMBL: ENSMUSP00000116259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004987] [ENSMUST00000130643]
Predicted Effect probably benign
Transcript: ENSMUST00000004987
AA Change: Y155C

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000004987
Gene: ENSMUSG00000004865
AA Change: Y155C

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 158 1.8e-12 PFAM
Pfam:Pkinase 8 160 1.5e-25 PFAM
low complexity region 169 183 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126683
Predicted Effect probably damaging
Transcript: ENSMUST00000130643
AA Change: Y227C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116259
Gene: ENSMUSG00000004865
AA Change: Y227C

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 229 6.8e-11 PFAM
Pfam:Pkinase 80 231 5.6e-23 PFAM
low complexity region 241 255 N/A INTRINSIC
coiled coil region 264 297 N/A INTRINSIC
Pfam:Pkinase 468 646 3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145730
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/arginine protein kinase specific for the SR (serine/arginine-rich domain) family of splicing factors. The protein localizes to the nucleus and the cytoplasm. It is thought to play a role in regulation of both constitutive and alternative splicing by regulating intracellular localization of splicing factors. Alternative splicing of this gene results in multiple transcript variants. Additional alternatively spliced transcript variants have been described for this gene, but their full length nature have not been determined.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,083,042 E429G unknown Het
Akap12 T A 10: 4,357,405 V1405D probably damaging Het
Akap7 C T 10: 25,283,982 D107N possibly damaging Het
Arfgef1 A G 1: 10,199,727 probably null Het
Cacna1s T A 1: 136,098,375 probably null Het
Casc4 AGATGGTGATGGTG AGATGGTG 2: 121,925,697 probably benign Het
Ctsd T C 7: 142,377,333 Q274R probably benign Het
Dysf G A 6: 84,186,471 R1575Q probably damaging Het
Erich6b A T 14: 75,658,834 L53F possibly damaging Het
Exoc6 A C 19: 37,593,770 probably null Het
Fbxw19 A T 9: 109,486,065 V143E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fndc1 A G 17: 7,772,776 F696S unknown Het
Foxa3 G T 7: 19,015,015 Y102* probably null Het
Foxn1 A G 11: 78,365,966 M301T probably damaging Het
Foxp2 C T 6: 15,197,120 Q54* probably null Het
Glra1 T C 11: 55,532,382 E117G possibly damaging Het
Glt1d1 A T 5: 127,691,031 D234V probably damaging Het
Gm597 T A 1: 28,778,082 I290F probably damaging Het
Gulp1 T C 1: 44,773,281 I137T probably damaging Het
Itga8 A G 2: 12,160,350 V816A possibly damaging Het
Kdm4c G A 4: 74,315,649 probably benign Het
Krtap19-2 A G 16: 88,874,108 probably benign Het
Lcorl T C 5: 45,733,877 N378S possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mocos T C 18: 24,674,300 L363P probably damaging Het
Mycbp2 G T 14: 103,282,645 Y745* probably null Het
Nav3 A C 10: 109,883,678 N141K possibly damaging Het
Ncor1 T C 11: 62,343,011 N779S probably benign Het
Nebl G T 2: 17,393,268 Y414* probably null Het
Nf1 T G 11: 79,445,789 C1065G probably damaging Het
Nfib A G 4: 82,359,767 V216A probably damaging Het
Nub1 A T 5: 24,702,381 N354I possibly damaging Het
Nyap1 C T 5: 137,735,464 V436I probably benign Het
Olfr1029 A G 2: 85,975,453 D70G possibly damaging Het
Olfr498 T C 7: 108,466,262 F313L probably benign Het
Pde2a T A 7: 101,505,980 M570K probably damaging Het
Pfas T C 11: 68,991,470 S856G probably benign Het
Pkd1l2 T C 8: 117,068,116 E368G probably benign Het
Ptf1a G A 2: 19,447,158 V323M probably damaging Het
Ptprh T C 7: 4,549,505 Y920C probably damaging Het
Sergef T A 7: 46,614,776 D229V possibly damaging Het
Slc1a4 T C 11: 20,304,417 K483R probably benign Het
Slc26a6 G A 9: 108,857,956 R351H probably damaging Het
Slc6a19 G A 13: 73,685,829 T370I possibly damaging Het
Smpd5 T C 15: 76,294,557 S42P possibly damaging Het
Snx13 G A 12: 35,123,026 probably null Het
Sox10 G A 15: 79,156,302 S185L probably benign Het
Stambpl1 T A 19: 34,233,916 probably null Het
Stk36 A G 1: 74,626,591 R698G possibly damaging Het
Tas2r122 T A 6: 132,711,430 T167S probably damaging Het
Tlr12 A G 4: 128,615,863 S865P probably damaging Het
Trp53bp1 A G 2: 121,207,746 L1537P probably damaging Het
Vstm2a C A 11: 16,263,125 T170K possibly damaging Het
Xpo7 A T 14: 70,693,967 F304I probably damaging Het
Zfp286 T C 11: 62,780,970 probably benign Het
Zfp985 A T 4: 147,582,983 K103* probably null Het
Other mutations in Srpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Srpk1 APN 17 28606317 missense probably damaging 1.00
IGL01792:Srpk1 APN 17 28599467 splice site probably benign
IGL03153:Srpk1 APN 17 28592266 missense possibly damaging 0.57
H8562:Srpk1 UTSW 17 28602733 missense probably benign 0.32
R0481:Srpk1 UTSW 17 28590244 splice site probably benign
R1160:Srpk1 UTSW 17 28599774 missense probably benign 0.05
R2188:Srpk1 UTSW 17 28594189 missense probably damaging 1.00
R4640:Srpk1 UTSW 17 28608724 missense probably benign
R4716:Srpk1 UTSW 17 28622008 missense probably benign 0.16
R4880:Srpk1 UTSW 17 28591225 missense probably damaging 0.98
R5458:Srpk1 UTSW 17 28599472 splice site probably null
R6383:Srpk1 UTSW 17 28590062 missense probably damaging 1.00
R6766:Srpk1 UTSW 17 28602753 missense possibly damaging 0.85
R7483:Srpk1 UTSW 17 28594218 missense probably benign 0.11
X0058:Srpk1 UTSW 17 28602835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTTGGAAGAAATACCAGTCTC -3'
(R):5'- GCACCTGCGAACCCTCTCT -3'

Sequencing Primer
(F):5'- TGGAAGAAATACCAGTCTCTTTAATG -3'
(R):5'- GAACCCTCTCTCTGTGCGTTG -3'
Posted On2016-10-06