Incidental Mutation 'R5533:Exoc6'
ID433785
Institutional Source Beutler Lab
Gene Symbol Exoc6
Ensembl Gene ENSMUSG00000053799
Gene Nameexocyst complex component 6
Synonymsmsec15, Sec15l1, 4833405E05Rik, Sec15, hbd
MMRRC Submission 043091-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5533 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location37550418-37683245 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to C at 37593770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066439]
Predicted Effect probably null
Transcript: ENSMUST00000066439
SMART Domains Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799

DomainStartEndE-ValueType
low complexity region 265 273 N/A INTRINSIC
Pfam:Sec15 456 762 8.1e-109 PFAM
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,083,042 E429G unknown Het
Akap12 T A 10: 4,357,405 V1405D probably damaging Het
Akap7 C T 10: 25,283,982 D107N possibly damaging Het
Arfgef1 A G 1: 10,199,727 probably null Het
Cacna1s T A 1: 136,098,375 probably null Het
Casc4 AGATGGTGATGGTG AGATGGTG 2: 121,925,697 probably benign Het
Ctsd T C 7: 142,377,333 Q274R probably benign Het
Dysf G A 6: 84,186,471 R1575Q probably damaging Het
Erich6b A T 14: 75,658,834 L53F possibly damaging Het
Fbxw19 A T 9: 109,486,065 V143E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fndc1 A G 17: 7,772,776 F696S unknown Het
Foxa3 G T 7: 19,015,015 Y102* probably null Het
Foxn1 A G 11: 78,365,966 M301T probably damaging Het
Foxp2 C T 6: 15,197,120 Q54* probably null Het
Glra1 T C 11: 55,532,382 E117G possibly damaging Het
Glt1d1 A T 5: 127,691,031 D234V probably damaging Het
Gm597 T A 1: 28,778,082 I290F probably damaging Het
Gulp1 T C 1: 44,773,281 I137T probably damaging Het
Itga8 A G 2: 12,160,350 V816A possibly damaging Het
Kdm4c G A 4: 74,315,649 probably benign Het
Krtap19-2 A G 16: 88,874,108 probably benign Het
Lcorl T C 5: 45,733,877 N378S possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mocos T C 18: 24,674,300 L363P probably damaging Het
Mycbp2 G T 14: 103,282,645 Y745* probably null Het
Nav3 A C 10: 109,883,678 N141K possibly damaging Het
Ncor1 T C 11: 62,343,011 N779S probably benign Het
Nebl G T 2: 17,393,268 Y414* probably null Het
Nf1 T G 11: 79,445,789 C1065G probably damaging Het
Nfib A G 4: 82,359,767 V216A probably damaging Het
Nub1 A T 5: 24,702,381 N354I possibly damaging Het
Nyap1 C T 5: 137,735,464 V436I probably benign Het
Olfr1029 A G 2: 85,975,453 D70G possibly damaging Het
Olfr498 T C 7: 108,466,262 F313L probably benign Het
Pde2a T A 7: 101,505,980 M570K probably damaging Het
Pfas T C 11: 68,991,470 S856G probably benign Het
Pkd1l2 T C 8: 117,068,116 E368G probably benign Het
Ptf1a G A 2: 19,447,158 V323M probably damaging Het
Ptprh T C 7: 4,549,505 Y920C probably damaging Het
Sergef T A 7: 46,614,776 D229V possibly damaging Het
Slc1a4 T C 11: 20,304,417 K483R probably benign Het
Slc26a6 G A 9: 108,857,956 R351H probably damaging Het
Slc6a19 G A 13: 73,685,829 T370I possibly damaging Het
Smpd5 T C 15: 76,294,557 S42P possibly damaging Het
Snx13 G A 12: 35,123,026 probably null Het
Sox10 G A 15: 79,156,302 S185L probably benign Het
Srpk1 T C 17: 28,602,759 Y227C probably damaging Het
Stambpl1 T A 19: 34,233,916 probably null Het
Stk36 A G 1: 74,626,591 R698G possibly damaging Het
Tas2r122 T A 6: 132,711,430 T167S probably damaging Het
Tlr12 A G 4: 128,615,863 S865P probably damaging Het
Trp53bp1 A G 2: 121,207,746 L1537P probably damaging Het
Vstm2a C A 11: 16,263,125 T170K possibly damaging Het
Xpo7 A T 14: 70,693,967 F304I probably damaging Het
Zfp286 T C 11: 62,780,970 probably benign Het
Zfp985 A T 4: 147,582,983 K103* probably null Het
Other mutations in Exoc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Exoc6 APN 19 37589876 missense possibly damaging 0.68
IGL01716:Exoc6 APN 19 37682964 missense probably damaging 0.98
IGL02363:Exoc6 APN 19 37608954 missense probably damaging 1.00
IGL02383:Exoc6 APN 19 37578474 missense probably benign
IGL03394:Exoc6 APN 19 37599572 missense probably benign 0.15
australamerican UTSW 19 37598679 critical splice donor site probably null
IGL03046:Exoc6 UTSW 19 37593769 critical splice donor site probably null
R1156:Exoc6 UTSW 19 37682897 missense probably benign 0.05
R1489:Exoc6 UTSW 19 37597120 missense possibly damaging 0.71
R1747:Exoc6 UTSW 19 37639769 splice site probably null
R2125:Exoc6 UTSW 19 37590941 missense probably damaging 1.00
R2863:Exoc6 UTSW 19 37653413 missense probably benign 0.34
R4090:Exoc6 UTSW 19 37571912 missense probably benign
R4666:Exoc6 UTSW 19 37570505 missense probably damaging 0.97
R4674:Exoc6 UTSW 19 37609082 missense probably damaging 1.00
R5382:Exoc6 UTSW 19 37598679 critical splice donor site probably null
R5471:Exoc6 UTSW 19 37599617 missense probably benign 0.30
R5607:Exoc6 UTSW 19 37578529 missense probably benign 0.01
R5641:Exoc6 UTSW 19 37587633 splice site probably null
R5759:Exoc6 UTSW 19 37573741 nonsense probably null
R5889:Exoc6 UTSW 19 37582245 missense probably damaging 1.00
R6592:Exoc6 UTSW 19 37571912 missense probably benign
R6936:Exoc6 UTSW 19 37571863 missense probably benign 0.00
R6988:Exoc6 UTSW 19 37609091 missense probably damaging 1.00
R7088:Exoc6 UTSW 19 37577010 missense probably damaging 0.99
R7162:Exoc6 UTSW 19 37577118 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGGGTAATGAGTGGCTTCC -3'
(R):5'- TTGTTCCCAAATCCCCAAGAAATTC -3'

Sequencing Primer
(F):5'- TTTTAAACAAAACTGTAGGAGCTGGG -3'
(R):5'- AGAAATTCCTACTTCATCTAAACAGC -3'
Posted On2016-10-06