Incidental Mutation 'R5555:Skint11'
ID435325
Institutional Source Beutler Lab
Gene Symbol Skint11
Ensembl Gene ENSMUSG00000057977
Gene Nameselection and upkeep of intraepithelial T cells 11
SynonymsA630098G03Rik
MMRRC Submission 043112-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5555 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location114163384-114245028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114194601 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 49 (T49A)
Ref Sequence ENSEMBL: ENSMUSP00000127138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079915] [ENSMUST00000145797] [ENSMUST00000151810] [ENSMUST00000164297]
Predicted Effect probably benign
Transcript: ENSMUST00000079915
SMART Domains Protein: ENSMUSP00000078836
Gene: ENSMUSG00000057977

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145797
AA Change: T49A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000118895
Gene: ENSMUSG00000057977
AA Change: T49A

DomainStartEndE-ValueType
Pfam:C2-set_2 29 113 6.4e-7 PFAM
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151810
AA Change: T23A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119157
Gene: ENSMUSG00000057977
AA Change: T23A

DomainStartEndE-ValueType
Pfam:C2-set_2 3 87 6e-7 PFAM
transmembrane domain 112 134 N/A INTRINSIC
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164297
AA Change: T49A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127138
Gene: ENSMUSG00000057977
AA Change: T49A

DomainStartEndE-ValueType
PDB:4F8T|A 19 125 6e-9 PDB
Blast:IG_like 40 119 1e-10 BLAST
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T A 5: 9,422,296 probably null Het
Atg7 T C 6: 114,702,053 V366A probably damaging Het
Cadm2 A T 16: 66,784,815 V192E probably damaging Het
Chil6 C T 3: 106,389,952 S291N possibly damaging Het
D7Ertd443e T C 7: 134,349,591 T118A probably benign Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dnah1 T A 14: 31,290,819 T1837S probably damaging Het
Ext1 A G 15: 53,088,143 V515A probably damaging Het
Fer1l4 T C 2: 156,048,189 E272G probably damaging Het
Fras1 T A 5: 96,677,377 H1475Q probably benign Het
Grid1 T C 14: 35,520,705 S672P possibly damaging Het
Gtpbp4 A G 13: 8,979,427 probably null Het
Hsp90aa1 A T 12: 110,692,734 V543E probably damaging Het
Irf5 T C 6: 29,531,146 S4P probably benign Het
Kif2b G T 11: 91,575,460 Q666K probably benign Het
Macc1 A T 12: 119,450,375 H762L probably benign Het
Map1s C T 8: 70,917,107 T941M probably damaging Het
Mrgprb1 T A 7: 48,447,775 I130F probably benign Het
Nbeal1 T G 1: 60,237,152 V684G possibly damaging Het
Ngly1 C T 14: 16,270,508 Q173* probably null Het
Plcb3 A T 19: 6,966,219 M104K probably benign Het
Plcg2 T A 8: 117,612,995 Y1048* probably null Het
Ptprf T C 4: 118,224,924 Y1039C probably damaging Het
Rab38 A G 7: 88,430,487 Y29C probably damaging Het
Rcan2 T A 17: 44,037,030 V210E probably damaging Het
Rptn A T 3: 93,396,701 Q447L probably benign Het
Scel G A 14: 103,602,206 R495K probably benign Het
Scn11a G T 9: 119,755,238 P1437Q probably damaging Het
Sim2 A G 16: 94,109,456 D239G probably damaging Het
Skap2 A G 6: 51,860,018 Y356H probably damaging Het
Snx33 G A 9: 56,925,397 H463Y probably benign Het
Steap2 T C 5: 5,677,544 T264A possibly damaging Het
Stk40 T A 4: 126,135,059 V238E probably damaging Het
Sun2 T C 15: 79,734,127 D277G probably benign Het
Ttll9 T C 2: 152,990,100 probably null Het
Vmn1r54 G A 6: 90,269,365 C87Y probably benign Het
Other mutations in Skint11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Skint11 APN 4 114194709 missense probably benign 0.03
IGL00775:Skint11 APN 4 114194692 missense probably damaging 1.00
IGL02186:Skint11 APN 4 114244636 missense possibly damaging 0.82
IGL02499:Skint11 APN 4 114194604 missense probably benign 0.01
IGL02622:Skint11 APN 4 114194728 missense probably damaging 1.00
IGL03115:Skint11 APN 4 114244623 missense probably damaging 0.99
R0513:Skint11 UTSW 4 114194565 missense probably benign 0.00
R0928:Skint11 UTSW 4 114244601 missense possibly damaging 0.95
R1486:Skint11 UTSW 4 114194818 critical splice donor site probably null
R1508:Skint11 UTSW 4 114231766 critical splice donor site probably null
R1667:Skint11 UTSW 4 114194781 missense probably damaging 0.99
R1807:Skint11 UTSW 4 114194696 missense probably benign 0.08
R2504:Skint11 UTSW 4 114228812 missense possibly damaging 0.55
R4165:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4166:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4231:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4233:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4234:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4236:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4756:Skint11 UTSW 4 114194677 missense probably benign 0.30
R4947:Skint11 UTSW 4 114191510 missense possibly damaging 0.89
R5237:Skint11 UTSW 4 114244845 missense possibly damaging 0.66
R5538:Skint11 UTSW 4 114231762 missense probably damaging 0.99
R6004:Skint11 UTSW 4 114231728 missense probably benign 0.37
R6209:Skint11 UTSW 4 114244710 missense possibly damaging 0.73
R7121:Skint11 UTSW 4 114227796 missense probably benign 0.05
R7208:Skint11 UTSW 4 114231747 missense probably damaging 1.00
R7348:Skint11 UTSW 4 114244722 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CCACAGCCTGTGTTTGACTTG -3'
(R):5'- GCTTACCTGATAGGATAATACTTCTCC -3'

Sequencing Primer
(F):5'- ATTGTGACTATCCATACTCCCAATG -3'
(R):5'- AGGATAATACTTCTCCTTTTCTCCTG -3'
Posted On2016-10-24