Incidental Mutation 'R5667:D430042O09Rik'
ID444476
Institutional Source Beutler Lab
Gene Symbol D430042O09Rik
Ensembl Gene ENSMUSG00000032743
Gene NameRIKEN cDNA D430042O09 gene
Synonyms
MMRRC Submission 043310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5667 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location125707888-125874793 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 125843455 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069660] [ENSMUST00000124223]
Predicted Effect probably null
Transcript: ENSMUST00000069660
SMART Domains Protein: ENSMUSP00000065744
Gene: ENSMUSG00000032743

DomainStartEndE-ValueType
internal_repeat_3 442 586 9.64e-5 PROSPERO
internal_repeat_2 454 607 1.91e-6 PROSPERO
low complexity region 704 718 N/A INTRINSIC
Pfam:DUF4457 909 1099 5.1e-43 PFAM
Pfam:DUF4457 1205 1524 8.4e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122337
SMART Domains Protein: ENSMUSP00000113734
Gene: ENSMUSG00000032743

DomainStartEndE-ValueType
Pfam:DUF4457 173 344 2.7e-9 PFAM
Pfam:DUF4457 218 394 3.2e-10 PFAM
low complexity region 444 458 N/A INTRINSIC
Pfam:DUF4457 660 742 1.1e-14 PFAM
Pfam:DUF4457 733 863 2.6e-31 PFAM
Pfam:DUF4457 944 1008 5.9e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124223
SMART Domains Protein: ENSMUSP00000118668
Gene: ENSMUSG00000032743

DomainStartEndE-ValueType
internal_repeat_3 416 560 8.9e-5 PROSPERO
internal_repeat_2 428 581 1.74e-6 PROSPERO
low complexity region 678 692 N/A INTRINSIC
Pfam:DUF4457 882 1073 1.4e-39 PFAM
Pfam:DUF4457 1179 1498 2.2e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205462
Meta Mutation Damage Score 0.612 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel, evolutionarily conserved, ciliary protein. In human hTERT-RPE1 cells, the protein is found at the base of cilia, decorating the ciliary axoneme, and enriched at the ciliary tip. The protein binds to microtubules in vitro and regulates their stability when it is overexpressed. A null mutation in this gene has been associated with Joubert syndrome, a recessive disorder that is characterized by a distinctive mid-hindbrain and cerebellar malformation and is also often associated with wider ciliopathy symptoms. Consistently, in a serum-starvation ciliogenesis assay, human fibroblast cells derived from patients with the mutation display a reduced number of ciliated cells with abnormally long cilia. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit variable obstructive hydrocephaly and enlarged lateral ventricles resulting from a blockage of cerebrospinal fluid flow in the cerebral aqueduct but show no gross defects in ventricular ependymal cilium structure or motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Adamts16 A T 13: 70,836,375 Y56* probably null Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Btbd10 T C 7: 113,332,724 K165R probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxa1 A T 12: 57,542,295 S380T probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lmbr1l A C 15: 98,907,608 D337E possibly damaging Het
Lrrn3 A C 12: 41,452,298 S673R possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Mycn A T 12: 12,940,044 M117K possibly damaging Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Plekhg2 A T 7: 28,367,639 I356N probably damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Trpv4 A G 5: 114,634,556 L371P probably damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in D430042O09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:D430042O09Rik APN 7 125795450 missense possibly damaging 0.75
IGL00950:D430042O09Rik APN 7 125843221 missense probably benign
IGL01089:D430042O09Rik APN 7 125795313 missense probably damaging 1.00
IGL01099:D430042O09Rik APN 7 125865320 missense probably damaging 1.00
IGL01449:D430042O09Rik APN 7 125870685 missense probably damaging 1.00
IGL01545:D430042O09Rik APN 7 125752971 critical splice acceptor site probably null
IGL01937:D430042O09Rik APN 7 125854605 missense probably benign 0.13
IGL01949:D430042O09Rik APN 7 125761842 nonsense probably null
IGL02096:D430042O09Rik APN 7 125814821 missense probably benign 0.09
IGL02148:D430042O09Rik APN 7 125873476 unclassified probably null
IGL02274:D430042O09Rik APN 7 125770570 critical splice acceptor site probably null
IGL02323:D430042O09Rik APN 7 125842829 missense probably benign 0.04
IGL02574:D430042O09Rik APN 7 125829753 missense possibly damaging 0.48
IGL02639:D430042O09Rik APN 7 125872792 missense probably damaging 1.00
IGL02833:D430042O09Rik APN 7 125850412 nonsense probably null
IGL03003:D430042O09Rik APN 7 125851960 missense probably damaging 1.00
IGL03011:D430042O09Rik APN 7 125852002 missense probably benign 0.01
IGL03332:D430042O09Rik APN 7 125820105 nonsense probably null
IGL03368:D430042O09Rik APN 7 125868858 intron probably benign
E0370:D430042O09Rik UTSW 7 125850302 missense probably benign 0.06
PIT4498001:D430042O09Rik UTSW 7 125813596 missense probably benign
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0472:D430042O09Rik UTSW 7 125872967 missense probably damaging 0.98
R0479:D430042O09Rik UTSW 7 125843346 missense probably benign 0.20
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1223:D430042O09Rik UTSW 7 125760423 missense possibly damaging 0.75
R1299:D430042O09Rik UTSW 7 125852023 missense probably benign
R1331:D430042O09Rik UTSW 7 125866455 missense probably benign 0.00
R1484:D430042O09Rik UTSW 7 125816571 splice site probably benign
R1507:D430042O09Rik UTSW 7 125866352 missense probably damaging 1.00
R1562:D430042O09Rik UTSW 7 125842848 missense probably damaging 1.00
R1992:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R2008:D430042O09Rik UTSW 7 125860566 missense probably damaging 1.00
R2010:D430042O09Rik UTSW 7 125872956 missense possibly damaging 0.93
R2147:D430042O09Rik UTSW 7 125865320 missense probably damaging 1.00
R2508:D430042O09Rik UTSW 7 125795343 missense probably benign
R3015:D430042O09Rik UTSW 7 125866340 missense probably damaging 1.00
R3794:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R3795:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R4043:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4044:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4692:D430042O09Rik UTSW 7 125867669 critical splice donor site probably null
R4772:D430042O09Rik UTSW 7 125865351 missense probably damaging 0.96
R5155:D430042O09Rik UTSW 7 125872184 missense probably damaging 1.00
R5467:D430042O09Rik UTSW 7 125843355 missense possibly damaging 0.65
R5551:D430042O09Rik UTSW 7 125820077 missense probably damaging 1.00
R5560:D430042O09Rik UTSW 7 125854561 missense probably benign 0.00
R5662:D430042O09Rik UTSW 7 125842703 missense probably benign 0.00
R5838:D430042O09Rik UTSW 7 125867655 missense possibly damaging 0.88
R5958:D430042O09Rik UTSW 7 125813635 missense probably benign 0.01
R5983:D430042O09Rik UTSW 7 125850373 missense probably damaging 1.00
R6084:D430042O09Rik UTSW 7 125814865 missense probably benign
R6241:D430042O09Rik UTSW 7 125872834 missense probably benign 0.00
R6298:D430042O09Rik UTSW 7 125870697 missense probably benign 0.11
R6345:D430042O09Rik UTSW 7 125752987 missense probably damaging 0.97
R6554:D430042O09Rik UTSW 7 125850742 missense probably damaging 1.00
R6715:D430042O09Rik UTSW 7 125761829 nonsense probably null
R6745:D430042O09Rik UTSW 7 125770650 missense probably benign 0.00
R7178:D430042O09Rik UTSW 7 125866327 missense probably benign 0.00
R7210:D430042O09Rik UTSW 7 125872239 missense probably damaging 1.00
U24488:D430042O09Rik UTSW 7 125770681 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCATGGGTGATACTCCTGGAG -3'
(R):5'- TCCTGGTGTCAGTGACAATC -3'

Sequencing Primer
(F):5'- AAAAAGGCCCTCGTCGTG -3'
(R):5'- TCACATCTAGGAGTTTAACAGGCAG -3'
Posted On2016-11-09