Incidental Mutation 'R5807:Fcamr'
ID448562
Institutional Source Beutler Lab
Gene Symbol Fcamr
Ensembl Gene ENSMUSG00000026415
Gene NameFc receptor, IgA, IgM, high affinity
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5807 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130800902-130814740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130811526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 188 (S188P)
Ref Sequence ENSEMBL: ENSMUSP00000108096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027670] [ENSMUST00000112477]
Predicted Effect probably damaging
Transcript: ENSMUST00000027670
AA Change: S132P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027670
Gene: ENSMUSG00000026415
AA Change: S132P

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 87 191 1.19e-5 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
transmembrane domain 456 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112477
AA Change: S188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108096
Gene: ENSMUSG00000026415
AA Change: S188P

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
IG 143 247 1.19e-5 SMART
low complexity region 264 276 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
transmembrane domain 512 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125056
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Homozygous null mice have enhanced germinal center formation, affinity maturation and memory induction of IgG3 producing B cells after immunization with T cell-independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,303,492 L943P probably damaging Het
Abcg5 C A 17: 84,672,291 V214F probably damaging Het
Ang T A 14: 51,101,429 probably benign Het
Arfgef3 A G 10: 18,647,798 probably null Het
Arhgef4 A G 1: 34,807,615 probably benign Het
Atp11b T C 3: 35,812,279 I409T probably damaging Het
Atp5b G A 10: 128,088,562 probably benign Het
Atp9a G A 2: 168,653,534 A660V probably damaging Het
Avpr1a A G 10: 122,449,471 T223A probably benign Het
Bmp2k T C 5: 97,063,494 M507T unknown Het
Cep295 A G 9: 15,332,532 S287P probably damaging Het
Chrna7 T A 7: 63,148,601 D111V probably damaging Het
Cnr2 A G 4: 135,917,436 D275G probably benign Het
Col28a1 T A 6: 8,158,144 M305L probably benign Het
Cpb1 T A 3: 20,263,742 D206V probably damaging Het
Cyp2c50 T C 19: 40,113,500 L453S probably damaging Het
Ddx52 T G 11: 83,949,682 S284A probably benign Het
Efcab1 A T 16: 14,916,972 I69F probably benign Het
Eif2ak4 G T 2: 118,388,851 R48L probably benign Het
Esrrb A G 12: 86,514,401 E303G possibly damaging Het
Fbxo21 A G 5: 117,976,868 E23G probably benign Het
Fer1l6 C A 15: 58,590,550 S818* probably null Het
Fn1 T C 1: 71,648,059 D213G probably damaging Het
Gcg A G 2: 62,475,725 I176T possibly damaging Het
Glis1 T A 4: 107,568,082 S109T probably benign Het
Gm266 T C 12: 111,485,739 D11G probably benign Het
Gm5070 C A 3: 95,410,654 noncoding transcript Het
Gm8444 T C 15: 81,843,453 probably benign Het
Gm8989 T A 7: 106,330,223 noncoding transcript Het
Golga4 A G 9: 118,527,130 T117A probably damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc2 T A 7: 56,230,919 F4766L probably damaging Het
Inhbc C A 10: 127,357,542 E202* probably null Het
Kcnu1 C T 8: 25,849,714 T20I possibly damaging Het
Klhdc3 T C 17: 46,677,465 D161G probably damaging Het
Krt84 T A 15: 101,530,212 K280M probably damaging Het
Krtap9-5 T A 11: 99,949,069 C199S unknown Het
Mrgprb3 A G 7: 48,643,362 V147A probably benign Het
Ndufs6 A T 13: 73,327,434 F48L probably damaging Het
Obscn T C 11: 59,079,650 S2586G probably damaging Het
Olfr148 A G 9: 39,614,463 R299G probably benign Het
Olfr156 C A 4: 43,820,912 V150L probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Osbpl6 A G 2: 76,584,513 D416G probably damaging Het
Pdilt A G 7: 119,500,543 probably benign Het
Phf12 C A 11: 78,022,426 D401E probably benign Het
Pla2r1 C T 2: 60,428,721 V1108M possibly damaging Het
Prim2 A G 1: 33,480,406 probably benign Het
Ptpn6 T C 6: 124,724,984 H406R probably benign Het
Qpctl G T 7: 19,143,207 H329N probably damaging Het
Ripk3 T A 14: 55,785,298 N390Y probably damaging Het
Rnase1 A G 14: 51,145,450 V149A probably benign Het
Rtn3 T A 19: 7,456,827 D581V probably damaging Het
Slamf1 A G 1: 171,775,062 Y119C probably damaging Het
Slc25a34 A G 4: 141,623,662 M12T probably benign Het
Tmem38a A G 8: 72,580,100 Y141C probably damaging Het
Tnr C T 1: 159,886,930 T793I possibly damaging Het
Tns3 T C 11: 8,493,211 D384G probably damaging Het
Vmn2r116 T A 17: 23,387,307 Y398N probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Other mutations in Fcamr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Fcamr APN 1 130813214 missense probably benign 0.01
IGL02880:Fcamr APN 1 130813334 missense probably benign 0.00
IGL03199:Fcamr APN 1 130812918 missense probably damaging 1.00
IGL03392:Fcamr APN 1 130800948 utr 5 prime probably benign
IGL03398:Fcamr APN 1 130803248 missense probably damaging 0.97
R1101:Fcamr UTSW 1 130814486 splice site probably null
R1312:Fcamr UTSW 1 130811487 missense probably damaging 1.00
R1351:Fcamr UTSW 1 130813020 missense possibly damaging 0.83
R1387:Fcamr UTSW 1 130804642 missense possibly damaging 0.85
R1475:Fcamr UTSW 1 130814484 splice site probably null
R1728:Fcamr UTSW 1 130804569 missense probably benign 0.06
R1728:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1728:Fcamr UTSW 1 130811580 missense probably benign
R1728:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1728:Fcamr UTSW 1 130812692 missense probably benign
R1728:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1728:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1728:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1728:Fcamr UTSW 1 130814597 missense probably benign
R1729:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1729:Fcamr UTSW 1 130811580 missense probably benign
R1729:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1729:Fcamr UTSW 1 130812692 missense probably benign
R1729:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1729:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1729:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1729:Fcamr UTSW 1 130814597 missense probably benign
R1730:Fcamr UTSW 1 130811580 missense probably benign
R1730:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1730:Fcamr UTSW 1 130812692 missense probably benign
R1730:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1730:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1730:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1730:Fcamr UTSW 1 130814597 missense probably benign
R1739:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1739:Fcamr UTSW 1 130811580 missense probably benign
R1739:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1739:Fcamr UTSW 1 130812692 missense probably benign
R1739:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1739:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1739:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1739:Fcamr UTSW 1 130814597 missense probably benign
R1762:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1762:Fcamr UTSW 1 130811580 missense probably benign
R1762:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1762:Fcamr UTSW 1 130812692 missense probably benign
R1762:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1762:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1762:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1762:Fcamr UTSW 1 130814597 missense probably benign
R1783:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1783:Fcamr UTSW 1 130811580 missense probably benign
R1783:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1783:Fcamr UTSW 1 130812692 missense probably benign
R1783:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1783:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1783:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1783:Fcamr UTSW 1 130814597 missense probably benign
R1784:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1784:Fcamr UTSW 1 130811580 missense probably benign
R1784:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1784:Fcamr UTSW 1 130812692 missense probably benign
R1784:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1784:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1784:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1784:Fcamr UTSW 1 130814597 missense probably benign
R1785:Fcamr UTSW 1 130804569 missense probably benign 0.06
R1785:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1785:Fcamr UTSW 1 130811580 missense probably benign
R1785:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1785:Fcamr UTSW 1 130812692 missense probably benign
R1785:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1785:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1785:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1785:Fcamr UTSW 1 130814597 missense probably benign
R1793:Fcamr UTSW 1 130811547 missense probably benign 0.03
R2085:Fcamr UTSW 1 130811598 missense probably damaging 1.00
R3937:Fcamr UTSW 1 130804576 missense probably damaging 0.97
R4529:Fcamr UTSW 1 130804576 missense probably damaging 0.99
R4624:Fcamr UTSW 1 130803262 missense probably damaging 0.99
R4822:Fcamr UTSW 1 130812686 missense possibly damaging 0.82
R5055:Fcamr UTSW 1 130811437 missense probably damaging 1.00
R5514:Fcamr UTSW 1 130814056 missense probably damaging 1.00
R6077:Fcamr UTSW 1 130812926 missense probably damaging 1.00
R6200:Fcamr UTSW 1 130803190 missense probably benign 0.16
R6653:Fcamr UTSW 1 130813202 missense possibly damaging 0.89
X0012:Fcamr UTSW 1 130812734 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTTCTGACAAGTGGAGTCGG -3'
(R):5'- AGACACAGTCAGATTCACGCTG -3'

Sequencing Primer
(F):5'- CAAGTGGAGTCGGTAATTAACTCTCC -3'
(R):5'- CGCTGAAGAATAGCATGTCGTTTC -3'
Posted On2016-12-15