Incidental Mutation 'R5715:Olfr622'
ID451111
Institutional Source Beutler Lab
Gene Symbol Olfr622
Ensembl Gene ENSMUSG00000050085
Gene Nameolfactory receptor 622
SynonymsMOR26-1, GA_x6K02T2PBJ9-6362863-6361910
MMRRC Submission 043336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5715 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103638451-103642702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 103639802 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 113 (S113A)
Ref Sequence ENSEMBL: ENSMUSP00000151149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058744] [ENSMUST00000213536] [ENSMUST00000216570]
Predicted Effect probably damaging
Transcript: ENSMUST00000058744
AA Change: S113A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058312
Gene: ENSMUSG00000050085
AA Change: S113A

DomainStartEndE-ValueType
Pfam:7tm_4 32 312 4.2e-100 PFAM
Pfam:7TM_GPCR_Srsx 36 308 2.3e-6 PFAM
Pfam:7tm_1 42 293 6.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213536
AA Change: S113A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216337
Predicted Effect probably damaging
Transcript: ENSMUST00000216570
AA Change: S113A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,207,977 Y56H possibly damaging Het
9930111J21Rik2 T A 11: 49,019,950 Y552F probably damaging Het
Asprv1 T A 6: 86,628,614 D147E probably benign Het
Atg4c G T 4: 99,258,402 L405F probably damaging Het
Birc6 C T 17: 74,631,620 L2670F probably damaging Het
Cdc20 T C 4: 118,434,818 D379G probably damaging Het
Chd6 T C 2: 160,949,878 M2520V probably benign Het
Clca4b A G 3: 144,913,257 V707A probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col12a1 A T 9: 79,616,065 C2743* probably null Het
Coq6 C A 12: 84,366,907 D70E probably benign Het
Cspg4 T A 9: 56,891,051 V1450D possibly damaging Het
Dnah7a A G 1: 53,413,778 L3847P probably damaging Het
Drd2 T A 9: 49,404,889 H316Q probably benign Het
Dusp19 T A 2: 80,630,986 N206K probably benign Het
Fam13c T G 10: 70,534,840 F270C probably damaging Het
Fam20a T C 11: 109,678,431 E246G probably damaging Het
Fbxo31 A G 8: 121,578,563 F65L probably damaging Het
Fshr T A 17: 88,986,396 probably null Het
Fstl4 T C 11: 53,000,416 V127A possibly damaging Het
Gdpd4 A T 7: 97,961,597 I75F probably benign Het
Gm13128 A G 4: 144,331,300 D159G possibly damaging Het
Grm5 C A 7: 88,130,256 A968E probably benign Het
Gucy2g A C 19: 55,233,155 F305V possibly damaging Het
Hivep3 T C 4: 120,096,373 F629L probably benign Het
Hoxb1 A G 11: 96,366,326 E167G probably benign Het
Hoxd4 T C 2: 74,727,364 L29P probably damaging Het
Ikbkb A G 8: 22,678,850 L211P probably damaging Het
Insc T C 7: 114,849,841 V499A probably benign Het
Irak3 A T 10: 120,142,736 H511Q possibly damaging Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Lurap1l T A 4: 80,953,721 S150R possibly damaging Het
Mab21l3 C T 3: 101,823,407 R172Q probably benign Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Mettl21a A T 1: 64,615,155 S68T probably benign Het
Mlxip T A 5: 123,440,058 W146R probably damaging Het
Mpp2 T A 11: 102,062,261 N285I probably damaging Het
Mrgprb4 T C 7: 48,199,039 N47S probably damaging Het
Msi2 A G 11: 88,386,063 Y237H probably damaging Het
Muc4 C T 16: 32,751,916 T598I possibly damaging Het
Musk A T 4: 58,333,663 I253F probably damaging Het
Myo5b G T 18: 74,742,175 C1550F possibly damaging Het
Nckap5l T C 15: 99,423,576 T1137A probably benign Het
Neb T C 2: 52,251,768 D3009G probably damaging Het
Nxph1 T A 6: 9,247,740 V237E probably damaging Het
Pla2g12a A G 3: 129,894,942 K150E probably damaging Het
Ptpn23 G A 9: 110,387,075 R1238W probably damaging Het
Pts C T 9: 50,522,278 G124R probably damaging Het
Rfk A T 19: 17,398,638 I99F probably benign Het
Rictor A T 15: 6,750,716 R151* probably null Het
Scn2a T A 2: 65,717,584 I1040N probably benign Het
Serinc5 A C 13: 92,706,202 T387P probably damaging Het
Sh3bp5l A G 11: 58,346,015 Q266R possibly damaging Het
Slc14a2 T C 18: 78,158,336 Y656C probably damaging Het
Slc26a3 T A 12: 31,448,843 probably null Het
Slc3a2 G T 19: 8,708,230 H168Q probably benign Het
Smarca2 A T 19: 26,649,122 I449L probably benign Het
Smarcc1 T C 9: 110,196,367 V704A possibly damaging Het
Sox13 A G 1: 133,386,183 probably null Het
Sptbn5 T C 2: 120,072,504 E7G probably damaging Het
Stard10 A G 7: 101,321,903 D26G probably damaging Het
Tap1 A T 17: 34,192,894 R91* probably null Het
Tgfbrap1 A T 1: 43,059,937 V239D possibly damaging Het
Tmem209 A T 6: 30,497,923 Y124* probably null Het
Tmprss2 T A 16: 97,568,983 E327V possibly damaging Het
Ttbk1 T C 17: 46,479,207 Y104C probably damaging Het
Ttll10 A T 4: 156,045,391 F154I probably damaging Het
Ubn2 T A 6: 38,461,477 Y40* probably null Het
Ubr5 A T 15: 38,002,233 S1519T probably benign Het
Ugt3a1 A C 15: 9,306,344 D193A probably damaging Het
Upf1 A T 8: 70,352,978 Y6N probably damaging Het
Vmn2r103 A T 17: 19,794,939 D447V probably benign Het
Vps39 T C 2: 120,325,236 N519S possibly damaging Het
Zfp109 T C 7: 24,229,570 E138G possibly damaging Het
Znrf3 A C 11: 5,286,239 V157G possibly damaging Het
Other mutations in Olfr622
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Olfr622 APN 7 103639832 missense probably damaging 1.00
IGL02972:Olfr622 APN 7 103639894 missense probably damaging 1.00
PIT4434001:Olfr622 UTSW 7 103639847 missense probably damaging 1.00
R1487:Olfr622 UTSW 7 103639594 missense probably damaging 1.00
R1989:Olfr622 UTSW 7 103639495 missense probably damaging 1.00
R3880:Olfr622 UTSW 7 103639624 missense probably benign 0.33
R4595:Olfr622 UTSW 7 103640101 missense probably damaging 1.00
R4989:Olfr622 UTSW 7 103640101 missense probably damaging 1.00
R5840:Olfr622 UTSW 7 103639256 missense probably benign 0.05
R6046:Olfr622 UTSW 7 103639679 missense probably benign 0.01
R6207:Olfr622 UTSW 7 103640002 missense probably benign 0.29
R6294:Olfr622 UTSW 7 103639591 missense probably damaging 1.00
R6392:Olfr622 UTSW 7 103639682 missense probably benign
R6522:Olfr622 UTSW 7 103639297 missense probably damaging 1.00
R6996:Olfr622 UTSW 7 103639858 missense probably benign 0.10
R7069:Olfr622 UTSW 7 103639960 missense probably damaging 0.99
R7251:Olfr622 UTSW 7 103639702 missense probably damaging 1.00
X0018:Olfr622 UTSW 7 103639598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTCACAGTAAGTATGAGGG -3'
(R):5'- ATCAAGCTGGAGCCAAGTCTC -3'

Sequencing Primer
(F):5'- GACATATTTTGTATAGTAAGGCAGCC -3'
(R):5'- TGGAGCCAAGTCTCCACCAG -3'
Posted On2017-01-03