Incidental Mutation 'R5723:Ifit1bl2'
ID452355
Institutional Source Beutler Lab
Gene Symbol Ifit1bl2
Ensembl Gene ENSMUSG00000067297
Gene Nameinterferon induced protein with tetratricopeptide repeats 1B like 2
Synonyms2010002M12Rik
MMRRC Submission 043341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5723 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34617049-34640743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34620058 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 53 (F53L)
Ref Sequence ENSEMBL: ENSMUSP00000108082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087357] [ENSMUST00000112463]
Predicted Effect probably benign
Transcript: ENSMUST00000087357
AA Change: F53L

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093816
Gene: ENSMUSG00000067297
AA Change: F53L

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112463
AA Change: F53L

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108082
Gene: ENSMUSG00000067297
AA Change: F53L

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,953,619 D862G possibly damaging Het
Abcg2 C T 6: 58,678,351 Q109* probably null Het
Acbd7 A G 2: 3,340,418 Y33C probably damaging Het
Actl7a A G 4: 56,744,310 D279G probably damaging Het
Akr1c18 A T 13: 4,144,329 Y110* probably null Het
Akt1 T C 12: 112,657,270 K276E probably damaging Het
Bcas2 A G 3: 103,177,292 probably benign Het
C9 T A 15: 6,486,816 Y367N probably damaging Het
Cd163 A G 6: 124,319,063 T789A probably benign Het
Cers6 T A 2: 69,108,445 S344T probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Crisp3 A C 17: 40,235,913 V38G probably damaging Het
Cyp2b23 A G 7: 26,681,396 F135L probably benign Het
Ddr2 A T 1: 169,988,520 C539* probably null Het
Efna5 T A 17: 62,607,463 D189V probably damaging Het
Endov G T 11: 119,499,849 V70F probably damaging Het
Fam49b A T 15: 63,956,598 probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem3 A T 8: 80,613,397 H773L probably benign Het
Gm43302 T A 5: 105,217,486 Q552L possibly damaging Het
Gramd1a A T 7: 31,134,483 W506R probably damaging Het
Hmcn1 C T 1: 150,694,849 V2188I possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Krt16 A G 11: 100,248,446 Y149H probably damaging Het
Krtap5-2 A T 7: 142,175,005 C313S unknown Het
Mreg A G 1: 72,162,368 I155T probably damaging Het
Nans T C 4: 46,499,083 F130S probably benign Het
Nox4 T C 7: 87,304,973 probably benign Het
Olfr178 A T 16: 58,889,613 Y202* probably null Het
Olfr411 C A 11: 74,347,128 W32L possibly damaging Het
Olfr600 A T 7: 103,346,619 M103K possibly damaging Het
Olfr679 C A 7: 105,091,102 C179F probably damaging Het
Pkd1 A G 17: 24,565,523 T348A probably benign Het
Poteg T C 8: 27,449,992 probably null Het
Prom1 T G 5: 44,014,894 N585T probably benign Het
Rfc1 T C 5: 65,277,426 S666G probably null Het
Rilp A G 11: 75,512,861 probably benign Het
Serpina3i A G 12: 104,265,500 E132G probably benign Het
Serpina3m T C 12: 104,393,911 V414A probably damaging Het
Sfrp4 T C 13: 19,623,698 F89S probably damaging Het
Stat5a A G 11: 100,882,074 H692R probably benign Het
Tex29 A T 8: 11,854,279 probably benign Het
Tmc5 T A 7: 118,672,193 F910I probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tusc3 G A 8: 39,071,497 G230D possibly damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Upb1 A T 10: 75,428,271 I184F probably damaging Het
Vamp4 T C 1: 162,574,363 F5L possibly damaging Het
Zfp583 C A 7: 6,323,675 Q68H probably damaging Het
Zfp831 A C 2: 174,645,407 H625P probably benign Het
Zfp941 G A 7: 140,812,850 probably benign Het
Other mutations in Ifit1bl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ifit1bl2 APN 19 34619919 missense probably benign 0.22
IGL00706:Ifit1bl2 APN 19 34618882 missense probably benign 0.09
IGL01322:Ifit1bl2 APN 19 34619004 missense probably benign 0.10
IGL01362:Ifit1bl2 APN 19 34619484 missense probably benign 0.04
IGL03061:Ifit1bl2 APN 19 34619724 missense probably benign 0.41
R0039:Ifit1bl2 UTSW 19 34619446 nonsense probably null
R1079:Ifit1bl2 UTSW 19 34619485 missense probably benign 0.00
R1438:Ifit1bl2 UTSW 19 34619169 missense possibly damaging 0.70
R2050:Ifit1bl2 UTSW 19 34619470 missense possibly damaging 0.75
R2104:Ifit1bl2 UTSW 19 34619520 missense probably benign 0.01
R2228:Ifit1bl2 UTSW 19 34619230 missense possibly damaging 0.70
R2229:Ifit1bl2 UTSW 19 34619230 missense possibly damaging 0.70
R4468:Ifit1bl2 UTSW 19 34619068 nonsense probably null
R4517:Ifit1bl2 UTSW 19 34629764 start gained probably benign
R5935:Ifit1bl2 UTSW 19 34619728 missense probably benign 0.04
R6024:Ifit1bl2 UTSW 19 34620038 missense probably benign 0.00
R6083:Ifit1bl2 UTSW 19 34619817 missense possibly damaging 0.80
R6085:Ifit1bl2 UTSW 19 34619817 missense possibly damaging 0.80
R6280:Ifit1bl2 UTSW 19 34620134 missense possibly damaging 0.70
R6368:Ifit1bl2 UTSW 19 34619125 missense probably benign 0.00
R6905:Ifit1bl2 UTSW 19 34619590 missense possibly damaging 0.90
R7048:Ifit1bl2 UTSW 19 34619151 missense probably benign 0.04
R7355:Ifit1bl2 UTSW 19 34619661 missense probably damaging 1.00
R7447:Ifit1bl2 UTSW 19 34619574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGCCCCTGTGGTAATG -3'
(R):5'- GGGTATATGGTGACTTAGAACACTGG -3'

Sequencing Primer
(F):5'- TGTGGTAATGCAGCCAGGC -3'
(R):5'- CACTGGTTGATTCCTAGTACACAG -3'
Posted On2017-01-03